Regulation of gene expression

1. Regulation of gene expression

2. Gene expression • Gene expression is the process by which information from a gene is used in the synthesis of a functional gene product. These products are often proteins, but in non-protein coding genes such as rRNA genes or tRNA genes, the product is a functional RNA. The process of gene expression is used by all known life - eukaryotes (including multicellular organisms), prokaryotes (bacteria and archea) and viruses - to generate the macromolecular machinery for life.

3. Modes of gene expression • constitutive gene expression:mode is that a gene that is transcribed continually A housekeeping gene is typically a constitutive gene that is transcribed at a relatively constant level. The housekeeping gene's products are typically needed for maintenance of the cell. Housekeeping genes are used as internal standards in quantitative PCR since it is generally assumed that their expression is unaffected by experimental conditions • induction and repression of gene expression Induction: the process of gene expression upregulated in certain conditions. DNA damage induce damage and repair-related gene expression. Repression: the process of gene expression downregulated. tryptophan repress metabolism-related gene expression.

4. Temporal and spatial expression of gene • temporality： • The growth process of single cell and the growth state at different external environment are accompanied by a variety of alterations of gene expression. • There are also changes in multiple cells gene expression in different stages of individual development and different internal environments. spatiality： • The gene expression patterns of multiple cells which comsist different tissues and organs are very different

5. Regulation of gene expression and its modes • Whether gene expression and the level of expression are carried out under stringent control of organism • Regulation may happen at various levels of gene expression , but regulation of transcription regulation is the major level.

6. The basics of gene expression regulation at transcriptional level • cis-acting element usually considered to be DNA sequences that, via transcription factors or other trans-acting elements or factors, regulate the expression of genes on the same chromosome • Promoter Special regulatory element: operator Trans-acting factor:protein factors which can directly or indirectily bind to cis-acting DNA sequence to regulate gene expression RNA pclymerase activator protein or repressor protein。

7. Pre-transcription DNA transcription mRNA translation protein modification Active protein Section1 gene expression regulation in Prokaryotic organism

8. 一、Regulation at transcriptional level

10. Factorsaffecting transcription : 1. Promoter • Promoter structure • initiation site +1binding site -10recognition site -35 • Promoter determines the direction of transcription and the template strand Promoter determines the efficiency of primingDifferent promoter has different RNA polymerase affinity, so different priming efficiency. consensus sequence is a way of representing the results of a multiple sequence alignment, where related sequences are compared to each other, and similar functional sequence motifs are found. The consensus sequence shows which residues are most abundant in the alignment at each positionT80A95T45A60A50T96

11. 2. specific recognition between σ factor and promoter • There is only one RNA polymerase in prokaryotes, but having a variety of σ factors. α2ββ，σ Core enzyme σ factors holoenzyme • Different σ factors selectively recognize different promoters

12. E. Coli: Environmental changes can induce a specific σ factors, thus open a specific set of genes. σ70 recognizes conventional promoter. σ32 recognizes heat shock protein gene promoter.  42 ℃ induction of heat shock protein expression

13. 3、阻遏蛋白 （repressor） • proteins can repress gene expression at transcriptional level : negative regulation. Repressor is a DNA-binding protein , encoded by regulatory gene (i gene). It can specifically recognize and bind to operon and the repress transcription. • signaling molecule＋repressor protein——allosteristuc effect——binding to DNA（or de-binding DNA） inducerepressioninduce derepression

14. 4、positive regulatory protein • Enhancing transcription after binding to specific DNA sequence： • （1）CAP ：catabolite gene activation protein cAMP is a signal molecule whose prevalence is inversely proportional to that of glucose. in the absence of glucose, cAMP binds to the CAP, which in turn allows the CAP to bind to the CAP promoter. the prevalence of cAMP and binding of the CAP to the DNA significantly change the receptor conformation and increase the production of β-galactosidase, enabling the cell to digest the lactose needed to produce

15. positive regulatory protein • (2) Regulation of ntrC protein

16. 5、inversion protein • Inversion proteinis a site-specific recombinase。

17. 空载tRNA • relA • 氨基酸饥饿 • 魔斑核苷酸 • 核糖体生成减少 • rRNA转录减少 • RNA聚合酶 6、RNA pclymerase inhibitor • stringent response is a stress response that occurs in all prokaryotes and some plants in reaction to amino-acid starvation or carbon starvation. The stringent response is signaled by the alarmone(p)ppGpp, and is capable of modulating up to 1/3 of all genes in a cell. It causes the cell to divert resources away from growth and division and toward amino acid synthesis in order to promote survival until nutrient conditions improve. • (p)ppGpp production is mediated by the ribosome part and the ribosome-associated protein when there are few charged tRNAs available to bind to the ribosome

18. 7、attenuator Attenuator: refers to a specific regulatory sequence that, when transcribed into RNA, forms hairpin structures to stop translation when certain conditions are not met The attenuator plays an important regulatory role in prokaryotic cells because of the absence of the nucleus in prokaryoticorganisms.

19. 二、转录的调控机制 regulatory mechanism of transcription • It was found 100 years ago that lactose could induce the production of E. coli lactose-metabolizing enzymes. Jacob and Monod proposed lactose operon (operon) model and explained it’s mechanism in 1960. • The lac operon is an operon required for the transport and metabolism of lactose in Escherichia coli. It consists of three adjacent structural genes, a promoter, a and an operator. The lac operon is regulated by several factors including the availability of glucose and of lactose. Gene regulation of the lac operon was the first complex genetic regulatory mechanism to be elucidated and is one of the foremost examples of prokaryoticgene regulation

20. lactose operon • structure gene（z,y,a)：galactosidae, permease, transacetylase。 • regulatory gene(i)：repressor protein gene。 • regulatory sequence：promotor, operator gene, CAP sequence。

21. Metabolism of lactose

22. Regulatory gene • Cis-acting element • 1. RNA polymerase binding site: -10 and -35 • 2. repressor binding site。 • 3. CAP/CRPbinding site

23. Trans-acting factors • RNA polymerase • The lac repressor encoded by lac I, lies nearby the lac operon and is always expressed (constitutive). It is a tetramer of identical subunits. Each subunit contains a helix-turn-helix (HTH) motif capable of binding to DNA. The operator site where repressor binds is a DNA sequence with inverted repeat symmetry. The two DNA half-sites of the operator together bind to two of the subunits of the tetrameric repressor, • lactose repressor can hinder production of β-galactosidase in the absence of lactose. • Catabolite activator protein (CAP) to greatly increase production of β-galactosidase in the absence of glucose.

24. Repression of repressor to lac operon

25. Derepression by lactose

26. The regulational role of glucose

27. Dural regulation of Lac operon • The first control mechanism is the regulatory response to lactose, which uses repressor to hinder production of β-galactosidase in the absence of lactose. The lacI gene coding for the repressor lies nearby the lac operon and is always expressed (constitutive). If lactose is missing from the growth medium, the repressor binds very tightly to a short DNA sequence and interferes with binding of RNAP to the promoter, and therefore mRNA encoding LacZ and LacY is only made at very low levels. When cells are grown in the presence of lactose, however, a lactose metabolite called allolactose, which is a recombination of glucose and galactose, binds to the repressor, causing a change in its shape. Thus altered, the repressor is unable to bind to the operator, allowing RNAP to transcribe the lac genes and thereby leading to high levels of the encoded proteins. • The second control mechanism is a response to glucose, which uses the CAP to greatly increase production of β-galactosidase in the absence of glucose. cAMP binds to the CAP, which in turn allows the CAP to bind to the CAP promoter, which assists the RNAP in binding to the DNA. In the absence of glucose, the prevalence of cAMP and binding of the CAP to the DNA significantly increases the production of β-galactosidase, enabling the cell to digest the lactose needed to produce glucose. dural regulation

28. IPTG is frequently used as an inducer of the lac operon for physiological work. It binds to repressor and inactivates it, but is not a substrate for β-galactosidase. One advantage of IPTG for in vivo studies is that since it cannot be metabolized by E. coli its concentration remains constant and the rate of expression of lac p/o-controlled genes, is not a variable in the experiment. IPTG intake is dependent on the action of lactose permease

29. Regulation of trp operon • Trp operon is an operon - a group of genes that are used, or transcribed, together - that codes for the components for production of tryptophan • Repression negative repressive feedback mechanism. The repressor for the trp operon is produced upstream by the trpR gene, which is continually expressed at a low level. It creates monomers, which associate into tetramers. These tetramers are inactive and "floating" around within the cell. When tryptophan is present, it binds to the tryptophan repressor tetramers causing a change in conformation, which allows the repressor to bind the operator. This prevents RNA polymerase from binding to and transcribing the operon, so tryptophan is not produced from its precursor. When tryptophan is not present, the repressor is in its native conformation and cannot bind the operator region, so transcription is not inhibited by the repressor. • Attenuation a second mechanism of negative feedback in the trp operon. While the TrpR repressor decreases transcription by a factor of 70, attenuation can further decrease it by a factor of 10, thus allowing accumulated repression of about 700-fold. Attenuation is made possible by the fact that in prokaryotes (which have no nucleus), the ribosomes begin translating the mRNA while RNA polymerase is still transcribing the DNA sequence. This allows the process of translation to directly affect transcription of the operon

31. Structure of the attenuator

32. TrpL: leader transcript, the beginning of the transcribed genes of the trp operon is a sequence of 140 nucleotides .This transcript includes four short sequences designated 1-4. Sequence 1 is partially complementary to sequence 2, which is partially complementary to sequence 3, which is partially complementary to sequence 4. Thus, three distinct secondary structures (hairpins) can form: 1-2, 2-3 or 3-4. The hybridization of strands 1 and 2 to form the 1-2 structure prevents the formation of the 2-3 structure, while the formation of 2-3 prevents the formation of 3-4. The 3-4 structure is a transcription termination sequence, once it forms RNA polymerase will disassociate from the DNA and transcription of the structural genes of the operon will not occur.

34. Regulation of attenuator

36. 三、Regulation at translational level effect of S-D sequence on the translation stability of mRNA the role of mRNA interfering complementary RNA (mic RNA) effect of translation products on translation

37. 1、 the location ofS-D sequence • S-D sequence

38. the location ofS-D sequence • the distance between S-D sequence and initiation codon 7 or 8bp between SD sequence and initiation, the translation efficiency of a 500 times difference for recombinant IL-2 expression. • the structure of mRNA may hide SD sequence, thus affecting the translation.

39. Regulation of mRNA stability • T1/2 of mRNA in bacteria is short (ca 2min),regulation mechanism for rapid protein degradation is essential. Once the induction factors removed, the translation will stop. • Different degradation mechanisms are responsible for different mRNA degradation. • RNAse involed in mRNA degradation： • RNase I：single-strand specific endonuclease。 • RNase II：3’end of single strand-specific exonuclease。 • RNase III：double-strand specific endonuclease

40. 3、Regulation of small-molecule RNA • Bacteria express ompF at low osmotic pressure, while expression of ompC at high osmotic pressure. The expression of ompC inhibits ompF expression by micRNA .

41. mechanism of micRNA ompR • osmotic pressure leads to allosterism • hypotension • 启动子 • 启动子 • ompF • micF • ompC • mRNA ompR • ompF • Hypertonic • 启动子 • 启动子 • ompF • micF • ompC • mRNA • micRNA • mRNA • micRNA • ompC

42. 5’…GUUCUUAGGGGGUAUCUUUGACUACGAC…3’ NH2…Val Leu Arg Gly Tyr Leu Asp Tyr Asp…COOH 20 21 22 23 24 25 26 27 28 4、The regulation of translation products to the translation • Translation termination factor RF2 regulates translation itself: RF1: recognize UAG and UAA RF2: recognize UGA and UAA

43. pro-transcription DNA transcription hnRNA mRNA translation protein modication activity Section II regulationof gene expression in eukaryote • The regulation level of gene expression in eukaryote Processing posttranscription

44. The characteristics of gene expression regulation in Eukaryote • Diversity of regulatory signal ： • Prokyrote:Gene expression in prokyrote is regulated by enviroment and thus realized by enzyme expression • eukyrote：extracellular enviroment change cell communication。 • Complexicity of regualory mechanism： • More complex cis-acting elements and trans-cis factors • More levels and more modes of regulation

45. 一、regulation at the pre-transcriptional level • Loss of chromosome: • Changes of chromatin structure Euchromatin and heterochromatin Histone modification: changes in structure of nucleosome. • DNA methylation is a type of chemical modification of DNA that can be inherited and subsequently removed without changing the original DNA sequence. As such, it is part of the epigenetic code and is also the best characterized epigenetic mechanism. methylation of CpG sequences • Gene rearrangement occurs in vertabrate, which randomly selects and assembles segments of gene encoding specific protein with important roles in the immune system. This site-specific recombination reaction generates a diverse repertoire of T cell receptor (TCR) andimmunoglobulin (Ig) molecules that are necessary for the recognition of diverse antigen from bacterial,viral and parasitic invaders, and from dysfunctional cells such as tumor cells. • Gene duplication (or chromosomal duplication or gene amplification) is any duplication of a region of DNA that contains a gene; it may occur as an error in homolgous recombination, a retrotranslocation event, or duplication of an entire chromosome.

46. 1、Chromatin loss Occurred in inferior animals,such as protozoa, nematodes and insects, etc. the whole or part of the chromosome lose in somatic cell. Chromosome set of germ cell is retained.

47. 2、Effect of chromatin structure on gene expression • Heterochromatin and euchromatin: Heterochromatin highly condensed Its genes do not express and is insensitive to DNase I digestion. Euchromatin can be transcribed and is sensitive to DNase I digestion. • Effect of nucleosome structure on gene expression.

48. Effect of nucleosome structure on gene expression • Association and disassociation of nuclesome is related to acetylation, methylation and phospholation of histone • acetylation： • Occurred in H2A/2B/3/4，acetylation increase in S phase。 • Histone acetyl transferase (HAT) may coordinate other transcription factor to activate transcription • phosphorylation： • Mainly occurred in H1, H1 phospholation increase in M phase

49. 3、DNA methylation • DNA methylation is essential for normal development and is associated with a number of key processes including geneomic imprinting, X-chromosome inactivation, suppression of repetitive elements and carcinogenesis. • Between 60% and 90% of all CpGs are methylated in mammals.Unmethylated CpGs are grouped in clusters called “CpG island" that are present in the 5' regulatory region of many genes. Alterations of DNA methylation have been recognized as an important component of cancer development. Hypomethylation generally arises earlier and is linked to chromosomal instability and loss of imprinting, whereas hypermethylation is associated with promoters and can arise secondary to gene (oncogene suppressor) silencing, but might be a target for epigenetic therapy.

50. DNA methylation • DNA methylation may impact the transcription of genes in two ways. First, the methylation of DNA may itself physically impede the binding of transcriptional proteins to the gene secondly, methylated DNA may be bound by proteins known as methyl-CpG-binding domain proteins (MBDs). MBD proteins then recruit additional proteins to the locus, such as histone deacetylases and other chromatin remodelling proteins that can modify histones, thereby forming compact, inactive chromatin termed silent chromatin. This link between DNA methylation and chromatin structure is very important. In particular, loss of methyl-CpG-binding protein 2 (MeCP2) has been implicated in Rett syndrome and methyl-CpG binding domain protein 2 (MBD2) mediates the transcriptional silencing of hypermethylated genes in cancer.。