ruana
Uploaded by
1 SLIDES
165 VUES
10LIKES

UGGCGCCCGAACAGGGAC

DESCRIPTION

a. Stem. Loop 2. G U. Major Splice Donor. G G. U. A. C. G. A. U. Stem. Loop 1. A. Loop B. Loop A. G. C. C. G. G. G C. A. A G. G. C. G G. A. C. A. Principal Packaging Determinant. A. C. Dimerisation. A. C G G C A A G. C G A G. G C G. A. A. G.

1 / 1

Télécharger la présentation

UGGCGCCCGAACAGGGAC

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. a Stem Loop 2 G U Major Splice Donor G G U A C G A U Stem Loop 1 A Loop B Loop A G C C G G G C A A G G C G G A C A Principal Packaging Determinant A C Dimerisation A C G G C A A G C G A G G C G A A G Initiation Site G U C G U U C G C U C C G C A G A G U C A G A Stem Loop 3 A A U U U U C U A G C G G A G G G G A G G A G A U C G A C A U G b C G 5´-G UGGCGCCCGAACAGGGAC CUGAAAGCGAAAGGGAAACCAGAGGAG A U A Primer Binding Site Gag Initiation Codon U C G G G C G G C C G G C C G G C G U A G U G C A G A Stem Loop 4 AA A A 3´ G A 3´ G A 5´ C G U G C G G 5´ GGCAAUG GCGCGC CGUUGCC CCGUUGC CGCGCG GUAACGG C GUCGUUC CGGCAAG G C A C G GAACGGC CUUGCUG A G G A A A AA G 3´ 5´ A 5´ 3´ U - 3’ G A c

More Related