1 / 61

רפליקציה

טרנסקריפציה. טרנסלציה. רפליקציה. telomerase. Semiconservative replication. הכפלה משומרת למחצה. סרט ראשון. Cell Division and DNA Replication. Cell Cycle Regulators. Replication Initiation. Replication Commitment. Cell Growth & Completion of Replication. Cell Division. שאלה.

scash
Télécharger la présentation

רפליקציה

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. טרנסקריפציה טרנסלציה רפליקציה

  2. telomerase

  3. Semiconservative replication הכפלה משומרת למחצה סרט ראשון

  4. Cell Division and DNA Replication Cell Cycle Regulators Replication Initiation Replication Commitment Cell Growth & Completion of Replication Cell Division

  5. שאלה In man 104 to 105 sites

  6. כמה origin of replicationיש בגנום של הפרה? • 1. אחד • 2. אחד לכל כרומוזום • 3. אחד כל כ-100000 נוקלאוטידים • 4. אחד כל כ-1000 נוקלאוטידים

  7. מבנה אתר התחלת רפליקציה - ORI

  8. DnaBהליקאז helicase loader DnaC

  9. פרימאז פרימר: רצף קצר של נוקלאוטידים

  10. 5’ GCATTCAGCAA 3’ 3’ AGUCG 5’ RNA ריבוז DNAדיאוקסי פרימר: רצף קצר של נוקלאוטידים

  11. פולימראז – אינזים המוסיף נוקלאוטיד לנוקלאוטיד עפ"י תבנית הגדיל המשלים III פולימראז תמיד מסנטז מכיוון 5' ל3' DNA פולימראז דורש: • פרימאר עם קצה 3' OH • TEMPLATE גדיל קריאה • נוקלאוטידים

  12. g a b NTP

  13. DNA Polymerase להראות סרט Bacteria • Single Ori • Initiation or replication highly regulated • Once initiated replication forks move at ~400-500 bp/sec • Replicate 4.6 x 106 bp in ~40 minutes שאלה

  14. מה תפקידו של הליקאז? • 1. לפתוח זיווגי בסיסים • 2. למנוע מהדנא לחזור למצב דו-גדילי • 3. ליצר פרימר של רנא • 4. לסנטז גדיל משלים

  15. DNA SYNTHESIS REACTION שאלה 5' end of strand P P Base Base CH2 CH2 O O P P CH2 CH2 Base Base products O O H20 + 3' P P P P OH P Synthesis reaction Base CH2 P O CH2 5' Base O OH 3' 3' end of strand OH

  16. איזה סוג קצה של דנא יהיה ב-5'? 5’ 3’ • 1. קצה עם קבוצת OH. • 2. קצה עם פוספאט אחד. • 3. קצה עם שני פוספטים. • 4. קצה עם שלושה פוספטים 5’ 3’

  17. DNA Pol III activity • 5’ to 3’ DNA polymerase • Very processive: Once it locks on it does not let go • Very active: Adds 1,000 nucleotides/sec! • High fidelity (מדויק): has a 3’ to 5’ exonuclease activity that removes mismatches

  18. How good is Pol III? • 1 in 10,000 bases added are mismatched. • Of these, all but 1 in 1,000 are corrected by Pol III • E. coli genome 4,000,000 bp • 400 mismatches • Probably all will be corrected by Pol III

  19. בדיקת קריאה פולימראז III הוא בעל פעילות של 3' ל-5' אקסונוקלאז וזה רק כאשר לא הוסיף את הנוקלאוטיד הבא

  20. בהפסקות

  21. מזלג הרפליקציה

  22. פרגמנט אוקזקי

  23. ליגאז סרט רפליקציה

  24. Supercoiled DNA relaxed by gyrase & unwound by helicase + proteins: 5’ SSB Proteins Okazaki Fragments ATP 1 Polymerase III 2 Helicase + Initiator Proteins 3 Lagging strand 3’ primase base pairs 5’ Polymerase III RNA primer replaced by polymerase I & gap is sealed by ligase 5’  3’ Leading strand RNA Primer 3’

  25. DNA repair

  26. לפניך גדיל של DNA שעובר רפליקציה. איזה גדיל משלים יסונטאז? 5’ 3’ ב א • 1. מ-ב יסונטאז הגדיל הנגרר ומ-א הגדיל המוביל. • 2. מ-ב יסונטאז הגדיל המוביל ומ-א הגדיל הנגרר. • 3. מ-שניהם הגדיל המוביל. • 4. משניהם הגדיל הנגרר.

  27. topoisomerase

  28. טופואיזומראז כמוטרפיה Etoposide – topo II inhibitor

  29. DNA Replication DNA Polymerase held to DNA by clamp regulatory protein • Clamp protein releases DNA poly when runs into dsDNA • Assembly of clamp around DNA requires ATP hydrolysis • Remains on leading strand for long time; only on lagging strand for short time when it reaches 5’ end of proceeding Okazaki fragments

  30. Replication summery Replication Movie

  31. Simultaneous Replication Occurs via Looping of the Lagging Strand •Helicase unwinds helix •SSBPs prevent closure •DNA gyrase reduces tension •Association of core polymerase with template •DNA synthesis •Not shown: pol I, ligase

  32. Replication Termination of the Bacterial Chromosome • Termination: meeting of two replication forks and the completion of daughter chromosomes • Region 180o from ori contains replication fork traps: ori Chromosome Ter sites

  33. Replication Termination of the Bacterial Chromosome • One set of Ter sites arrest DNA forks progressing in the clockwise direction, a second set arrests forks in the counterclockwise direction: Chromosome TerA TerB

  34. RNase H activity

  35. תיאור הבעיה – קצוות חשופים של הכרומוזומים If this shoelace were a chromosome,then these two protective tips would be its Telomeres

  36. פיתרון הבעיה – הוספת רצפים חוזרים לקצוות בסיום הרפליקציה CHROMOSOME TELOMERE 3’ TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG 5’ AATCCCAATCCC

  37. TnAmGo type of minisatellite repeat TTAGGG – human TTTAGGG – Arabidopsis TTGGGG - Tetrahymena TTAGG – Bombyx TTTTAGGG – Chlamydomonas TTTTGGGG – Oxytricha TTAGGC - Ascaris (TG)1-3 - Saccharomyces cereviceae

  38. Telomere • senescent cells have shorter telomeres • תאים מזדקנים בעלי טלומרים קצרים • length differs between species • אורך הטלומר משתנה בין מינים שונים • in humans 8-14kb long • באדם אורכו בין 8-14 • telomere replication occurs late in the cell cycle • מחלוקה אחת לשנייה מתקצרים הטלומארים ב-40 עד 200 נוקלאוטידים.

  39. Functions • Provide protection from enzymatic degradation and maintain chromosome stability • מונע פרוק אינזימטי ושומר על הכרומוזומים • Organization of the cellular nucleus by serving as attaching points to the nuclear matrix • משמש נקודות מעגן למערך רשת הגרעין • Allows end of linear DNA to be replicated completely • מאפשר את סיום הרפליקציה של הכרומוזומים

  40. End-to-end fusion

  41. Telomerase • Telomerase binds to the telomer and the internal RNA component aligns with the existing telomer repeats. 2. Telomerase synthesizes new repeats using its own RNA component as a template 3. Telomerase repositions itself on the chromosome and the RNA template hybridizes with the DNA once more.

  42.  and Primase

More Related