'Ab gfp' diaporamas de présentation

Ab gfp - PowerPoint PPT Presentation


GFP-Pax Y118F : -- cl. 1 -- cl. 1 cl. 2

GFP-Pax Y118F : -- cl. 1 -- cl. 1 cl. 2

*. 35. vector. Pax Y118F cl.1. 30. Pax Y118F cl.2. 25. 20. 15. 10. 5. 0. 100. 80. 60. 40. 20. 0. A. v-Src. Colony-forming frequency (%). FAK+/+ FAK -/-. GFP-Pax Y118F : -- cl. 1 -- cl. 1 cl. 2. FAK+/+ [Src]. FAK-/- [Src].

By hyun-chong
(78 views)


View Ab gfp PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of Ab gfp PowerPoint presentations. You can view or download Ab gfp presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.

Recherches associées pour Ab gfp
GFP GFP-WT GFP-NES

GFP GFP-WT GFP-NES

GFP GFP-WT GFP-NES. CE NE CE NE CE NE. A. GFP-WT Annexin II. GFP. CE CE NE NE. GFP-NES mutant annexin II. B. PGK. PACP - + - +. 1 2 3 4 5 6. GFP-NES. C.

By ama (102 views)

gfp -

gfp -

Gene correction in trans: a model for gene therapy. gfp -. Luther Davis Jason Cummings Nancy Maizels. Gene correction in trans: a model for gene therapy. GFP +. Luther Davis Jason Cummings Nancy Maizels. nuclease. Gene correction in trans. Cut sites. eGFP. Poly-lacO. Puro. trGFP.

By arnie (128 views)

GFP

GFP

A. MSCV. MSCV. GFP-RV. 5 ‘ LTR. IRES. GFP. 3 ‘ LTR. 3 ‘ LTR. mIFN- . IRES. GFP. IFN/GFP-RV. 5 ‘ LTR. B. GFP-RV IFN/GFP-RV. 35%. 34%. 55%. 56%. CD 8. 2%. 2%. 8%. 8%. GFP. C. GFP-RV IFN/GFP-RV. 99%. 99%.

By marcos (148 views)

GFP

GFP

KIR3DSW08. KIR3DLW03. KIR3DL05. m ock. 2 nd Ab. 1C7. 2H5. PE-Cy5.5. 2H3. 2H9. GFP.

By kanan (105 views)

GFP

GFP

A. B. 5 ’- LTR. U6.2. shRNA. CMV. GFP. shRNA CONSTRUCT Scrambled GGATCCC GACGATTCGAGGCGCAGTGAT TTGATATCCG ATCACTGCGCCTCGAATCGT CTTTTTTCCAACTCGAG Cyp2b-KD2 GGATCCC AAGAACACTGAGGTGTACCCC TTGATATCCG GGGGTACACCTCAGTGTTCTT TTTTTTCCAACTCGAG

By nonnie (125 views)

GFP

GFP

A. Plasmid 1 GCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAAGCGGCCGCTCGAAATTGTAAAAAGCGGACCG Full-length 1 GCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAAGCGGCCGCTCGAAATTGTAAAAAGCGGACCG

By pilar (149 views)

GFP

GFP

By eden (117 views)

GFP

GFP

T 0. T 8. Untreated. G 1. 46%. 13%. 46%. S. 19%. 11%. 17%. G 2. 35%. 76%. 37%. T 0. T 8. Untreated. G 1. 44%. 8%. 45%. S. 14%. 6%. 16%. G 2. 42%. 86%. 39%. T 0. T 8. Untreated. G 1. 43%. 10%. 46%. S. 16%. 8%. 10%. G 2. 41%. 82%. 44%. GFP. A. B. GFP.

By muncel (92 views)

GFP

GFP

A. Van der Gun et al. B. pMX. ZF A SKD. ZF B VP64. EpCAM. GFP. Supplementary: Figure 1 Bidirectional EpCAM expression modulation. D. Van der Gun et al. C. E. Supplementary: Figure 1 Bidirectional EpCAM expression modulation.

By farica (119 views)

GFP

GFP

GFP. Discovery and First Applications. Discovery of GFP protein. 1960: Osamu Shimomura began studying bioluminescence in Aequorea victoria. 1962: Reported properties of aequorin , a protein which glows blue around Ca 2+ ions

By geneva (224 views)