'Appropriate amino acid' diaporamas de présentation

Fundamentals in Sequence Analysis 1.(part 1)

Fundamentals in Sequence Analysis 1.(part 1). Review of Basic biology + database searching in Biology. Hugues Sicotte NCBI. The Flow of Biotechnology Information. Gene. Function. > DNA sequence AATTCATGAAAATCGTATACTGGTCTGGTACCGGCAACAC TGAGAAAATGGCAGAGCTCATCGCTAAAGGTATCATCGAA

1.16k views • 75 slides

Fundamentals in Sequence Analysis 1.(part 1)

Fundamentals in Sequence Analysis 1.(part 1). Review of Basic biology + database searching in Biology. Hugues Sicotte NCBI. The Flow of Biotechnology Information. Gene. Function. > DNA sequence AATTCATGAAAATCGTATACTGGTCTGGTACCGGCAACAC TGAGAAAATGGCAGAGCTCATCGCTAAAGGTATCATCGAA

887 views • 75 slides

Polypeptide Synthesis -Making Proteins

Polypeptide Synthesis -Making Proteins. DNA controls the cell by directing the manufacture of proteins . Proteins are macromolecules made up of long chains of amino acids.

726 views • 55 slides

CHAPTER 21

656 views • 50 slides

CHAPTER 26 RNA Metabolism

CHAPTER 26 RNA Metabolism. Transcription: DNA-dependent synthesis of RNA RNA processing RNA silencing, RNA-dependent RNA and DNA polymerases. Key topics : . Overview of RNA Function. Ribonucleic acids play three well-understood roles in living cells

2.03k views • 46 slides

Translation

Translation . Protein Biosynthesis. Central Dogma. DNA. transcription. translation. RNA. protein. mRNAs are exported for translation. Through nuclear pore complex Recognizes and transports ONLY completed mRNA. Translation .

711 views • 42 slides

Protein Synthesis

Protein Synthesis. A gene is the basic unit of heredity in a living organism All living things depend on genes Genes hold the information to build and maintain their cells and pass genetic traits to offspring the term gene often refers to the scientific concept of an allele .

504 views • 33 slides

Warm Up:

Warm Up:. Place in order from largest to smallest: Chromosome Gene Cell Nucleus. M odern genetics. DNA. D eoxyribo n ucleic a cid Heredity information is encoded in DNA. James Watson and Francis Crick. April 1953 Double helix model for DNA. Rosalind Franklin.

442 views • 32 slides

Translation

Translation. How the Genetic Information Is Used to Build a Protein. transcription. initial transcript RNA. processing. mature RNA. translation. Protein. Information Flow From DNA. replication. DNA. Properties of the Genetic Code. Triplet 3 nucleotides code for 1 amino acid

467 views • 26 slides

Molecular Genetics

371 views • 25 slides

CELL PHYSIOLOGY

CELL PHYSIOLOGY. CELLS ARE THE BASIC UNIT OF LIFE. CELL ORGANELLES. Mitochondrion. Nucleus. CELL ORGANELLES. Cell Membrane Nucleus Endoplasmic reticulum Golgi complex Mitochondria Lysosomes Microfilaments and microtubules Vesicles. THE NUCLEUS. Site of DNA (In chromosomes)

339 views • 16 slides

RNA

366 views • 14 slides

Announcements

Announcements. Homework for Chapter 7 Part 2 due Wednesday Remember, lab 4 is Thursday No online quiz because it was due days ago Check your email at least 3 times a day!. Chapter 7, Part 2: The Blueprint of Life, from DNA to Protein. The Players In Translation. Ribosome. mRNA.

197 views • 13 slides

Protein Synthesis

313 views • 7 slides

R ibosomes

R ibosomes. Presented by: TaylorSkye Goff-Gramando. What is a Ribosome?. Ribosomes are the protein builders of the cell . Tiny organelles that are either freely moving or in small clusters They are found in all living cells. Where Are They Located.

188 views • 7 slides

The Double Helix

DNA has 2 polynucleotide strands that are held together by hydrogen bonds. The two strands are coiled together to form a helical structure known as the double helix. The polynucleotide backbone is on the outside of the helix, and the bases are on the inside.

224 views • 4 slides