100+ Called single gene PowerPoint (PPT) Presentations, Called single gene PPTs

Called single gene - PowerPoint PPT Presentation

A single strand of DNA is made of letters: ATGCTCGAATAAATGTGAATTTGA

A single strand of DNA is made of letters: ATGCTCGAATAAATGTGAATTTGA The letters make words: ATG CTC GAA TAA ATG TGA ATT TGA The words make sentences: <ATG CTC GAA TAA> <ATG TGA ATT TGA> These "sentences" are called genes. Genes tell the cell to make other molecules called proteins

★ ★ ★ ★ ★

619 views • 17 slides

View Called single gene PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of Called single gene PowerPoint presentations. You can view or download Called single gene presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.

'Called single gene' diaporamas de présentation

Called single gene - PowerPoint PPT Presentation

A single strand of DNA is made of letters: ATGCTCGAATAAATGTGAATTTGA