'Colored lines' diaporamas de présentation

Acupuncture & moxibustion techniques

Acupuncture & moxibustion techniques. Acu tech Electro-acu Other types of needles: seven star, tacks, three edged, etc Nine needles Moxa tech Cupping Bleeding Gua-sha( scrapping). Miscellaneous. Different needling techniques in Classics Micro-systems of the body Nose Eye

1.26k views • 64 slides

Regional Climate Change Impacts on Water Resources

813 views • 50 slides

Status and results from the OPERA experiment

Status and results from the OPERA experiment. Tomok o Ariga on behalf of the OPERA collaboration A. Einstein Center for Fundamental Physics LHEP, University of Bern. OPERA. Oscillation parameters in the atmospheric neutrino sector.

484 views • 34 slides

Practical Geological Application of Fourier Theory

Practical Geological Application of Fourier Theory . Japan Earthquake 3/11/2011. Climate and Milankovich Cycles. Japan Earthquake 3/11/2011. Earthquake Wave Types. Earthquake Wave Propagation. http://neic.usgs.gov/neis/eq_depot/2002/eq_021103/ak_seismic_waves.html

436 views • 30 slides

Gibbs sampling

Gibbs sampling. The Motif Finding Problem. Given a set of DNA sequences: cctgatagacgctatctggctatccacgtacgtaggtcctctgtgcgaatctatgcgtttccaaccat agtactggtgtacatttgatacgtacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc aaacgtacgtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaatttt

608 views • 26 slides

Constellations

Constellations. Create your own. Constellations group of stars that form a pattern in the sky The shapes you see all depend on your point of view. Stars in a constellation are NOT close to each other, but when viewed from Earth they seem to be grouped together.

396 views • 21 slides

Physics and the Quantum Mechanical Model

Section 5.3. Physics and the Quantum Mechanical Model. 5.3. Physics and the Quantum Mechanical Model.

330 views • 20 slides

356 views • 18 slides

289 views • 18 slides

317 views • 15 slides

Voices for Progress Project February, 2009 Administered by American Family Voices

Message Handbook for Progressives from Center to Left: How to Talk about The Economy. Voices for Progress Project February, 2009 Administered by American Family Voices. Project Summary and Methodology.

252 views • 11 slides

Bastard Fruit

Bastard Fruit. Lillian Smith & Dorothy Allison. Pressing Change from the Margins of Society. A kindly little white woman making big noise in Georgia A feminist Southern writing honestly about a past filled with abuse and incest. Allison Bio.

215 views • 9 slides

Solar cell efficiency, self-assembly and dipole-dipole interactions of isomorphic narrow bandgap

Solar cell efficiency, self-assembly and dipole-dipole interactions of isomorphic narrow bandgap molecules Alan J. Heeger, University of California-Santa Barbara, DMR 08566060.

184 views • 2 slides