'De novo assembly' diaporamas de présentation

De novo assembly - PowerPoint PPT Presentation

Introduction to NGS

Introduction to NGS

Introduction to NGS. Data Analysis Group. 2 nd August 2019. Outline. Sequencing history Current sequencing approaches File formats Quality assessment Read trimming DAG workflows The Sequence Read Archive. Key to slides…. Descriptive text

★ ★ ★ ★ ★

1.29k views • 71 slides
Next Generation Sequencing and Bioinformatics Analysis Pipelines

Next Generation Sequencing and Bioinformatics Analysis Pipelines

Next Generation Sequencing and Bioinformatics Analysis Pipelines. Adam Ameur National Genomics Infrastructure SciLifeLab Uppsala adam.ameur@igp.uu.se. Outline. Sequencing instruments and ‘ standard ’ analyses IonTorrent/PacificBiosciences In-house bioinformatics analyses, some examples

★ ★ ★ ★ ★

599 views • 51 slides
De novo short read assembly Osvaldo Graña CNIO Bioinformatics Unit ograna@cnio.es Abril 2013

De novo short read assembly Osvaldo Graña CNIO Bioinformatics Unit ograna@cnio.es Abril 2013

Structural Biology and Biocomputing Programme. De novo short read assembly Osvaldo Graña CNIO Bioinformatics Unit ograna@cnio.es Abril 2013. Sequence assembly

★ ★ ★ ★ ★

526 views • 37 slides
RNA Assembly Using extending method.

RNA Assembly Using extending method.

RNA Assembly Using extending method. Wei Xueliang 2010-04-07. Overview. Why abandon deBruijn . Why abandon Extended deBruijn . Introduction to current method. Handle the old problem. The new problem. Tod o. Why abandon deBruijn . De Bruijn Graph’s ( dis )advantage: Very Fast.

★ ★ ★ ★ ★

326 views • 23 slides
Bioinformatics analysis pipeline for viral metagenomics

Bioinformatics analysis pipeline for viral metagenomics

Bioinformatics analysis pipeline for viral metagenomics. Davit Bzhalava, PhD Dept. of Laboratory Medicine, Karolinska Institutet , Sweden. Human Microbiota. We are born 100% human and we die 90% microbial.

★ ★ ★ ★ ★

324 views • 23 slides
Genovo : De Novo Assembly for Metagenomes

Genovo : De Novo Assembly for Metagenomes

Genovo : De Novo Assembly for Metagenomes. Gao Song 2010/07/14. Outline. Overview of Metagenomices Current Assemblers Genovo Assembly. Overview of Metagemices. Motivation. Metagenomics is: Why Do We Need Metagenomics ? Snapshot of bacterial community Cannot be cultivated. <1%.

★ ★ ★ ★ ★

422 views • 22 slides
genetic variation is meaningful only in the context of a population

genetic variation is meaningful only in the context of a population

ccagtcagag A tgtgcacatggcttagttttcataca G agcctgggctgggggtggggtg ccagtcagag A tgtgcacatggcttagttttcatacacagcctgggctgggggtggggtg ccagtcagagttgtgcacatggcttagttttcatacacagcctgggctgggggtggggtg ccagtcagag A tgtgcacatggcttagttttcatacacagcctgggctgggggtggggtg

★ ★ ★ ★ ★

248 views • 15 slides

View De novo assembly PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of De novo assembly PowerPoint presentations. You can view or download De novo assembly presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.