'Gapped alignments' diaporamas de présentation

NCBI Molecular Biology Resources

NCBI Molecular Biology Resources. Part 2. ICGEB, Trieste, Italy "BIOINFORMATICS: COMPUTER METHODS IN MOLECULAR BIOLOGY". Peter Cooper. June, 2004. Genome Resources. NM_000249: Genome Links. Higher Genome Resources. MLH1: UniGene Cluster. ESTs in UniGene. The Map Viewer.

885 views • 73 slides

NCBI Molecular Biology Resources

866 views • 71 slides

NCBI Molecular Biology Resources

890 views • 71 slides

Sequence Comparison of Database B asic L ocal A lignment S earch T ool

Sequence Comparison of Database B asic L ocal A lignment S earch T ool. Widely used similarity search tool Heuristic approach based on Smith Waterman algorithm Finds best local alignments Provides statistical significance All combinations (DNA/Protein) query and database .

725 views • 58 slides

Homology Search Tools

Homology Search Tools. Kun-Mao Chao ( ??? ) Department of Computer Science and Information Engineering National Taiwan University, Taiwan WWW: http://www.csie.ntu.edu.tw/~kmchao. Homology Search Tools. Smith-Waterman (Smith and Waterman, 1981; Waterman and Eggert, 1987)

437 views • 26 slides

Mapping Sequence Tags

Mapping Sequence Tags. Biological Sequence Analysis BNFO 691/602 Spring 2014 Mark Reimers. Raw Data Formats. Most common format is FASTQ Four rows per read @HWI-EAS255_4_FC2010Y_1_43_110_790 TTAATCTACAGAATAGATAGCTAGCATATATTT + hhhhhhhhhhhhhhhdhhhhhhhhhhhdRehdh

321 views • 19 slides

Gapped BLAST and PSI-BLAST: a new generation of protein database search programs

529 views • 15 slides

Introduction

APT Solution public class BLASTStageOne { public String stageOne(String query, String[] library, int w) { int topResemblance = 0; String bestResemblance = new String(); for ( int i = 0; i < library. length ; i++) { //explore the entire array int counter = 0;

129 views • 1 slides