'Genome biology' diaporamas de présentation

Advanced Bioinformatics (MB480/580)

Advanced Bioinformatics (MB480/580). >Sulfolobus virus 1 complete genome 15465 bp. TTCGCCCGCTTACCGACGTACTTCGGTGAGGAACCGGTAACGGAGTTAG TACGCCCATAAGTTGAAACATTATCTCGTTTCGAAAGGAGGAAGAGGAA GATATACTGAGAGTCCTACGCGTTAGTTCAGGTCAGACAAGAGAGAACG AAATCAATTCTGAAACAATTATTTGACCATGGTAAGGAACATGAAGATG

634 views • 49 slides

amo amos amot amomus amotis amont . Happy birthday Swiss-Prot Fortaleza August 2006

amo amos amot amomus amotis amont . Happy birthday Swiss-Prot Fortaleza August 2006. Three (Orthogonal) Ontologies. Biological Process Goal or objective within cell, tissue .. Molecular Function Elemental activity or task Cellular Component

436 views • 43 slides

Genome-Wide DNA Methylation Assays

Genome-Wide DNA Methylation Assays. Nadia Khan, Rick Smith, and Anna Kuperman Epigenetics 2012. Introduction. Most Genome Wide Approaches were adapted from technologies originally developed for detecting methylation at the level of a single gene Advantages of a Genome Wide Approach

828 views • 35 slides

Learn from chips: Microarray data analysis and clustering CS 374 Yu Bai Nov. 16, 2004

Learn from chips: Microarray data analysis and clustering CS 374 Yu Bai Nov. 16, 2004. Outlines. Background & motivation Algorithms overview fuzzy k-mean clustering (1 st paper) Independent component analysis(2 nd paper). CHIP-ing away at medical questions . Why does cancer occur?.

468 views • 31 slides

Learn from chips: Microarray data analysis and clustering CS 374 Yu Bai Nov. 16, 2004

Learn from chips: Microarray data analysis and clustering CS 374 Yu Bai Nov. 16, 2004. Outlines. Background & motivation Algorithms overview fuzzy k-mean clustering (1 st paper) Independent component analysis(2 nd paper). CHIP-ing away at medical questions . Why does cancer occur?.

430 views • 31 slides

360 views • 25 slides

Possible Biomarker for Autism

Possible Biomarker for Autism.

306 views • 20 slides