'Induced gfp proteins' diaporamas de présentation

Induced gfp proteins - PowerPoint PPT Presentation


pGLO™ Transformation and Purification of Green Fluorescent Protein (GFP)

pGLO™ Transformation and Purification of Green Fluorescent Protein (GFP)

pGLO™ Transformation and Purification of Green Fluorescent Protein (GFP). Instructors. Stan Hitomi Coordinator – Math & Science San Ramon Valley Unified School District Danville, CA Kirk Brown Lead Instructor, Edward Teller Education Center Science Chair, Tracy High School

By sheng
(196 views)

Purification of Green Fluorescent Protein (GFP)

Purification of Green Fluorescent Protein (GFP)

Purification of Green Fluorescent Protein (GFP). Instructors. Stan Hitomi Coordinator – Math & Science Principal – Alamo School San Ramon Valley Unified School District Danville, CA Kirk Brown Lead Instructor, Edward Teller Education Center Science Chair, Tracy High School

By zorana
(184 views)

pGLO™ Transformation and Purification of Green Fluorescent Protein (GFP)

pGLO™ Transformation and Purification of Green Fluorescent Protein (GFP)

pGLO™ Transformation and Purification of Green Fluorescent Protein (GFP). Workshop Time Line. Introduction Transform bacteria with pGLO plasmid Purify GFP using column chromatography. DNA. RNA. Protein. Trait. Central Framework of Molecular Biology. Links to Real-world.

By maxime
(265 views)

pGLO ™ Transformation and Purification of Green Fluorescent Protein (GFP)

pGLO ™ Transformation and Purification of Green Fluorescent Protein (GFP)

pGLO ™ Transformation and Purification of Green Fluorescent Protein (GFP). DNA. RNA. Protein. Trait. Central Framework of Molecular Biology. Links to Real-world. GFP is a visual marker Study of biological processes (example: synthesis of proteins)

By klaus
(1033 views)


View Induced gfp proteins PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of Induced gfp proteins PowerPoint presentations. You can view or download Induced gfp proteins presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.

Recherches associées pour Induced gfp proteins
GFP GFP-WT GFP-NES

GFP GFP-WT GFP-NES

GFP GFP-WT GFP-NES. CE NE CE NE CE NE. A. GFP-WT Annexin II. GFP. CE CE NE NE. GFP-NES mutant annexin II. B. PGK. PACP - + - +. 1 2 3 4 5 6. GFP-NES. C.

By ama (102 views)

gfp -

gfp -

Gene correction in trans: a model for gene therapy. gfp -. Luther Davis Jason Cummings Nancy Maizels. Gene correction in trans: a model for gene therapy. GFP +. Luther Davis Jason Cummings Nancy Maizels. nuclease. Gene correction in trans. Cut sites. eGFP. Poly-lacO. Puro. trGFP.

By arnie (128 views)

GFP

GFP

A. MSCV. MSCV. GFP-RV. 5 ‘ LTR. IRES. GFP. 3 ‘ LTR. 3 ‘ LTR. mIFN- . IRES. GFP. IFN/GFP-RV. 5 ‘ LTR. B. GFP-RV IFN/GFP-RV. 35%. 34%. 55%. 56%. CD 8. 2%. 2%. 8%. 8%. GFP. C. GFP-RV IFN/GFP-RV. 99%. 99%.

By marcos (148 views)

GFP

GFP

KIR3DSW08. KIR3DLW03. KIR3DL05. m ock. 2 nd Ab. 1C7. 2H5. PE-Cy5.5. 2H3. 2H9. GFP.

By kanan (105 views)

GFP

GFP

A. B. 5 ’- LTR. U6.2. shRNA. CMV. GFP. shRNA CONSTRUCT Scrambled GGATCCC GACGATTCGAGGCGCAGTGAT TTGATATCCG ATCACTGCGCCTCGAATCGT CTTTTTTCCAACTCGAG Cyp2b-KD2 GGATCCC AAGAACACTGAGGTGTACCCC TTGATATCCG GGGGTACACCTCAGTGTTCTT TTTTTTCCAACTCGAG

By nonnie (125 views)

GFP

GFP

A. Plasmid 1 GCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAAGCGGCCGCTCGAAATTGTAAAAAGCGGACCG Full-length 1 GCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAAGCGGCCGCTCGAAATTGTAAAAAGCGGACCG

By pilar (149 views)

GFP

GFP

By eden (117 views)

GFP

GFP

T 0. T 8. Untreated. G 1. 46%. 13%. 46%. S. 19%. 11%. 17%. G 2. 35%. 76%. 37%. T 0. T 8. Untreated. G 1. 44%. 8%. 45%. S. 14%. 6%. 16%. G 2. 42%. 86%. 39%. T 0. T 8. Untreated. G 1. 43%. 10%. 46%. S. 16%. 8%. 10%. G 2. 41%. 82%. 44%. GFP. A. B. GFP.

By muncel (92 views)

GFP

GFP

A. Van der Gun et al. B. pMX. ZF A SKD. ZF B VP64. EpCAM. GFP. Supplementary: Figure 1 Bidirectional EpCAM expression modulation. D. Van der Gun et al. C. E. Supplementary: Figure 1 Bidirectional EpCAM expression modulation.

By farica (119 views)

GFP

GFP

GFP. Discovery and First Applications. Discovery of GFP protein. 1960: Osamu Shimomura began studying bioluminescence in Aequorea victoria. 1962: Reported properties of aequorin , a protein which glows blue around Ca 2+ ions

By geneva (224 views)