'Like growth factor' diaporamas de présentation

Pituitary Gland ( Hypophysis )

Pituitary Gland ( Hypophysis ). Anterior pituitary hormones are classified into three families: . Somatomammotropin family (GH and PRL). Glycoprotein hormones (LH, FSH, and TSH). Opiomelanocortin family (ACTH, ?-endorphin, and related peptides). . Growth Hormone (GH).

1.51k views • 124 slides

2003-2004 Endocrine Pharmacology Review

2003-2004 Endocrine Pharmacology Review. 1 April 2014 3:43 PM. Acarbose. Oral hypoglycemic Alpha-glucosidase inhibitor Inhibitor of intestinal glucose absorption. Adrenocorticotropin (ACTH). Anterior pituitary hormone Anticonvulsant Stimulates synthesis and release of cortisol. Aldosterone.

1.38k views • 109 slides

EXAMINATIONS OF ENDOCRINE DISORDERS Dr. Pavel Maruna

EXAMINATIONS OF ENDOCRINE DISORDERS Dr. Pavel Maruna. Basic theses. Endocrine system. Together with nervous system, it is specialized in signalling, control and regulation of body processes. Mostly concerned in slower regulation (Time is needed to reach the target cells by blood )

1.12k views • 74 slides

Generalized Linear Models Classification

Generalized Linear Models Classification. SPH 247 Statistical Analysis of Laboratory Data. Generalized Linear Models . The type of predictive model one uses depends on a number of issues; one is the type of response.

1.03k views • 69 slides

Categories of Chemical Regulators

Categories of Chemical Regulators. Intracrine. Endocrine. Autocrine. Ectocrine. Paracrine. Endocrinology: study of hormones. General Features of the endocrine system:. Transport. Gland. Hormone. Target Cell. rich blood supply. hormone receptors are very specific.

650 views • 56 slides

Categories of Chemical Regulators

Categories of Chemical Regulators. Intracrine. Endocrine. Autocrine. Ectocrine. Paracrine. Endocrinology: study of hormones. General Features of the endocrine system:. Transport. Gland. Hormone. Target Cell. rich blood supply. hormone receptors are very specific.

784 views • 56 slides

Pairwise Sequence Alignment

Pairwise Sequence Alignment. WHAT?. WHAT?. Given any two sequences (DNA or protein) Seq 1: CATATTGCAGTGGTCCCGCGTCAGGCT S eq 2: TAAATTGCGTGGTCGCACTGCACGCT we are interested to know to what extent they are similar?. CATATTGCAGTGGTCCCGCGTCAGGCT TAAATTGCGT-GGTCGCACTGCACGCT. WHY?.

540 views • 49 slides

Kidney failure in infants and children

Kidney failure in infants and children. Presented by:Dr.Doaa Al-Masri Discussed by:Dr.Y.K.Abu-Osbaa Pediatrics in review vol.23 No.2 February 2002. Introduction .

761 views • 36 slides

Chapter 15: The Chromosomal Basis of Inheritance

607 views • 31 slides

FEMALE REPRODUCTIVE SYSTEM

FEMALE REPRODUCTIVE SYSTEM. Internal sex organs : ovary : gametogenesis and hormone production oviduct : oocyte transport uterus : embryo development vagina : External genital structures : vulva. External Genital Structures (I). Mons pubis Labia majora Labia minora Clitoris:

1.28k views • 28 slides

ENDOCRINE CONTROL OF GROWTH

ENDOCRINE CONTROL OF GROWTH. George Liapakis , PhD. What makes children grow ? . The continuous net protein synthesis. Growth of soft tissues . Lengthening of long bones. This occurs under the influence of growth hormone (GH ).

417 views • 24 slides

IGF-1

IGF-1. Insulin-Like Growth Factor 1 Matthew Klinka. Background. Primarily produced in the liver However is also a paracrine hormone Present in many cell types in a wide range of tissue types. Typically bound to proteins when both intra or extracellular 98% of IGF-1 is protein bound

1.12k views • 23 slides

*Sagitha Indrayana **I G N Wien Aryana

Comparation of IGF-1 LEVEL Between Femoral Fracture in White Rat Treated with and without Intrahematoma Rat Recombinant Leptin Injection . *Sagitha Indrayana **I G N Wien Aryana . Department of Orthopaedic and Traumatology Faculty of Medicine Udayana University

355 views • 21 slides

295 views • 18 slides

The Affects of Acromegaly on the Heart

The Affects of Acromegaly on the Heart. Pamela Pierre BIO 475-03. Symptoms of Acromegaly. Headaches Kidney failure Arthritis Type 2 Diabetes Heart failure (due to the enlargement of the heart). Physical Characteristics. Enlarged hands, arms, feet (extremities)

538 views • 17 slides

Gyn Oncology

368 views • 17 slides

Liver: anatomy & functions

424 views • 14 slides

Endocrinology

Endocrinology. Acromegaly. Acromegaly. Very rare Prevalence in the order of 1 in 200,000 Usually diagnosed between age 40 and 60 No difference in gender susceptibility Insidious onset. Pathogenesis. Most commonly caused by pituitary adenoma Increased secretion of growth hormone

288 views • 11 slides

Inheritance Patterns

Inheritance Patterns. Things that cause alterations in chromosome number or pattern lead to genetic disorders. Alterations in chromosome number - aneuploidy caused by nondisjunction failure of a chromosome to separate during meiosis

361 views • 5 slides

Transport: Binding Proteins

Transport: Binding Proteins. BINDING PROTEIN ABBREVIATION HORMONES BOUND. Corticosteroid-binding globulin CBG glucocorticoids and progesterone Sex-steroid binding globulin SBG or SSBG Testosterone and estradiol Progesterone-binding globulin PBG progesterone.

511 views • 1 slides