'Local alignment smith waterman' diaporamas de présentation

Local alignment smith waterman - PowerPoint PPT Presentation

Why do we want to align protein sequences?

Why do we want to align protein sequences?

Protein Sequence Comparison Patrice Koehl http://koehllab.genomecenter.ucdavis.edu/teaching/ecs129/06/lecture-notes. Why do we want to align protein sequences?. If two sequences align well, the corresponding proteins are homologous; they probably share the same structure and/or function

★ ★ ★ ★ ★

694 views • 50 slides
Pairwise Sequence Alignment

Pairwise Sequence Alignment

Pairwise Sequence Alignment. WHAT?. WHAT?. Given any two sequences (DNA or protein) Seq 1: CATATTGCAGTGGTCCCGCGTCAGGCT S eq 2: TAAATTGCGTGGTCGCACTGCACGCT we are interested to know to what extent they are similar?. CATATTGCAGTGGTCCCGCGTCAGGCT TAAATTGCGT-GGTCGCACTGCACGCT. WHY?.

★ ★ ★ ★ ★

601 views • 50 slides
Lecture 2 Identifying templates for protein modeling: Sequence alignment with BLAST and PSI-BLAST

Lecture 2 Identifying templates for protein modeling: Sequence alignment with BLAST and PSI-BLAST

Lecture 2 Identifying templates for protein modeling: Sequence alignment with BLAST and PSI-BLAST. Sources and additional information.

★ ★ ★ ★ ★

391 views • 39 slides
Dynamic Programming (DP)

Dynamic Programming (DP)

Dynamic Programming (DP). Three Steps: Initialization Matrix fill (scoring) Traceback (alignment) Global Alignment: Needleman-Wunsch Local Alignment: Smith-Waterman. G A A T T C A G T T A (sequence #1) G G A T C G A (sequence #2). http://www.avatar.se/molbioinfo2001/dynprog/dynamic.html.

★ ★ ★ ★ ★

468 views • 23 slides
Developing Pairwise Sequence Alignment Algorithms

Developing Pairwise Sequence Alignment Algorithms

Developing Pairwise Sequence Alignment Algorithms. Dr. Nancy Warter-Perez May 20, 2003. Outline. Group assignments for project Overview of global and local alignment References for sequence alignment algorithms Discussion of Needleman-Wunsch iterative approach to global alignment

★ ★ ★ ★ ★

354 views • 22 slides
Developing Pairwise Sequence Alignment Algorithms

Developing Pairwise Sequence Alignment Algorithms

Developing Pairwise Sequence Alignment Algorithms. Dr. Nancy Warter-Perez May 13, 2004. Outline. Group assignments for project Overview of global and local alignment References for sequence alignment algorithms Discussion of Needleman-Wunsch iterative approach to global alignment

★ ★ ★ ★ ★

402 views • 21 slides
BLAST

BLAST

BLAST. Anders Gorm Pedersen & Rasmus Wernersson. Database searching. Using pairwise alignments to search databases for similar sequences. Query sequence. Database. Database searching.

★ ★ ★ ★ ★

476 views • 17 slides

View Local alignment smith waterman PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of Local alignment smith waterman PowerPoint presentations. You can view or download Local alignment smith waterman presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.