'Many copies' diaporamas de présentation

Fundamentals in Sequence Analysis 1.(part 1)

Fundamentals in Sequence Analysis 1.(part 1). Review of Basic biology + database searching in Biology. Hugues Sicotte NCBI. The Flow of Biotechnology Information. Gene. Function. > DNA sequence AATTCATGAAAATCGTATACTGGTCTGGTACCGGCAACAC TGAGAAAATGGCAGAGCTCATCGCTAAAGGTATCATCGAA

1.16k views • 75 slides

Lesson Overview

Lesson Overview. 15.1 Selective Breeding. Show short videos from Nova. REVIEW. What are the two things that can get mutated (when talking DNA)? Yes! Genes & Chromosomes Did you know that some people make MUTATIONS on purpose?. THINK ABOUT IT. Where does popcorn come from?

747 views • 63 slides

Economic Epidemiology: An Operations Research Approach Fred Roberts, DIMACS

Economic Epidemiology: An Operations Research Approach Fred Roberts, DIMACS. Pearl Harbor, Hawaii, USA December 1941. World War II Led to Creation of the Field of Operations Research Operations Research in WWII: logistics optimal scheduling inventory strategic planning

721 views • 54 slides

758 views • 51 slides

Genetic Engineering Biotechnology

Genetic Engineering Biotechnology. What is Genetic Engineering?. The manipulation of a trait in an organism to create a desired change. We have been manipulating DNA for generations!. Artificial breeding creating new breeds of animals & new crop plants to improve our food. Animal breeding.

1.06k views • 41 slides

WAN Security & VPN

WAN Security & VPN Kaman Ng TEL660 19 Jan 2006 Need for Security? Online Trading Etrade, Schwab, TDWaterhouse, Fidelity, Ameritrade Online Banking Commerce Bank, Citibank, HSBC Online Purchases Ebay, BestBuy.com, BarnesandNobles.com Online Information

921 views • 38 slides

Disulfide Bonds

Disulfide Bonds. Two cyteines in close proximity will form a covalent bond Disulfide bond, disulfide bridge, or dicysteine bond. Significantly stabilizes tertiary structure. Determining Protein Structure. There are O(100,000) distinct proteins in the human proteome.

4.38k views • 36 slides

Lecture 12: MapReduce : Simplified Data Processing on Large Clusters

Lecture 12: MapReduce : Simplified Data Processing on Large Clusters. Xiaowei Yang (Duke University). Review. What is cloud computing? Novel cloud applications Inner workings of a cloud MapReduce: how to process large datasets using a large cluster Datacenter networking. Roadmap.

536 views • 32 slides

Viral genetics

Viral genetics. A sense of size. Comparing Eukaryote Bacterium virus. What is a virus?. DNA or RNA enclosed in a protein coat Viruses are not cells Extremely tiny Electron microscope size Smaller than ribosomes ~20-50 nm First discovered in plants (1800s) Tobacco mosaic virus

522 views • 30 slides

Laboratory Diagnosis of Tuberculosis

By Dr. Faten Aly Shoukry , Ph D Consultant & Head of Microbiology Department , Abbassia Chest Hospital. Laboratory Diagnosis of Tuberculosis. Types of Tuberculous Infections. I- Pulmonary Infection II- Extrapulmonary infections: a-TB Pleural effusion b- Tuberculous meningitis

3.98k views • 28 slides

The Case of the Druid Dracula: Clicker Case Version

by Norris Armstrong, Terry Platt, and Peggy Brickman. The Case of the Druid Dracula: Clicker Case Version. Adapted from Brickman (2004). The Case of the Druid Dracula . National Center for Case Study Teaching in Science, University at Buffalo, State University of New York. . The Crime.

766 views • 28 slides

Transport Tycoon 3D

552 views • 24 slides

Transport Tycoon 3D

446 views • 24 slides

Tessellation

Tessellation. Tessellation. If many copies of a shape can be used to cover a surface, without leaving any gaps between them, then we say that the shape will tessellate . The pattern that is formed is called a tessellation. Tessellations all around us.

769 views • 22 slides

Secure Sockets Layer

Secure Sockets Layer. SSL. SSL is a communications protocol layer which can be placed between TCP/IP and HTTP It intercepts web traffic and provides security between browser and server Encryption is used to guarantee secure communication in an insecure environment

427 views • 20 slides

Bacteria

Bacteria. Bacteriophage. Bacteriophage. -is a virus that infects bacteria. These are obligate intracellular parasites that multiply inside bacteria by making use of some or all of the host biosynthetic machinery. . Types of Bacteriophages.

350 views • 16 slides

Translation (Protein Synthesis)

Translation (Protein Synthesis). RNA ? protein. Making a protein. Many RNAs needed mRNA, tRNA, rRNA. Messenger RNA (mRNA ). Carries coded instructions for protein synthesis (translation) From the DNA in the nucleus to the ribosome. The genetic code. Codons

274 views • 14 slides

Principles of genetic engineering

Principles of genetic engineering. L Mathias. What is genetic engineering. Genetic engineering, also known as recombinant DNA technology , means altering the genes in a living organism to produce a Genetically Modified Organism (GMO) with a new genotype.

399 views • 13 slides

Principles of genetic engineering

Principles of genetic engineering. L Mathias. What is genetic engineering. Genetic engineering, also known as recombinant DNA technology , means altering the genes in a living organism to produce a Genetically Modified Organism (GMO) with a new genotype.

609 views • 13 slides

Chapter 17~ From Gene to Protein

Chapter 17~ From Gene to Protein. Protein Synthesis: overview. One gene-one enzyme hypothesis (Beadle and Tatum) One gene-one polypeptide (protein) hypothesis Transcription : synthesis of RNA under the direction of DNA (mRNA)

519 views • 12 slides