'Mol biol cell' diaporamas de présentation

Junguk Hur School of Informatics & Center for Genomics and Bioinformatics

Characterization of transcriptional responses to environmental stress by differential location analysis. Junguk Hur School of Informatics & Center for Genomics and Bioinformatics. Indiana University Bloomington, IN. OVERVIEW. Overview. Background / Motivation

553 views • 43 slides

Gene Expression Analysis Using Bayesian Networks

496 views • 37 slides

Cellerator: A System for Simulating Biochemical Reaction Networks

Cellerator: A System for Simulating Biochemical Reaction Networks. Bruce E Shapiro . Jet Propulsion Laboratory California Institute of Technology. bshapiro@jpl.nasa.gov. Part of a Biochemical Network.

521 views • 35 slides

Satellite Workshop: Information Processing in the Biological Organism (A Systems Biology Approach) Fred S. Roberts Rutg

Satellite Workshop: Information Processing in the Biological Organism (A Systems Biology Approach) Fred S. Roberts Rutgers University. We are all well aware by now that many fundamental biological processes involve the flow of information. TTAGGCCCCAATGTGTCCCGATTGAA

388 views • 28 slides

Analysis of Id-1 and Twist-1 Regulation in Bone Development

427 views • 22 slides