'Mouse cyp2b subfamily cyp2b9' diaporamas de présentation

Mouse cyp2b subfamily cyp2b9 - PowerPoint PPT Presentation


GFP

GFP

A. B. 5 ’- LTR. U6.2. shRNA. CMV. GFP. shRNA CONSTRUCT Scrambled GGATCCC GACGATTCGAGGCGCAGTGAT TTGATATCCG ATCACTGCGCCTCGAATCGT CTTTTTTCCAACTCGAG Cyp2b-KD2 GGATCCC AAGAACACTGAGGTGTACCCC TTGATATCCG GGGGTACACCTCAGTGTTCTT TTTTTTCCAACTCGAG

By nonnie
(132 views)


View Mouse cyp2b subfamily cyp2b9 PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of Mouse cyp2b subfamily cyp2b9 PowerPoint presentations. You can view or download Mouse cyp2b subfamily cyp2b9 presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.

Recherches associées pour Mouse cyp2b subfamily cyp2b9
Subfamily Myrmicinae

Subfamily Myrmicinae

Subfamily Myrmicinae. Compiled by Hilda Taylor. Subfamily Myrmicinae General Characteristics: Habitat: Largest subfamily - Deserts to tropical forests - Members of this subfamily have stingers or have modified stingers - Petiole and postpetiole are present

By farrah-pennington (59 views)

Subfamily Formicinae

Subfamily Formicinae

Subfamily Formicinae. Compiled by Hilda Taylor and William Mackay. Polyergus rufescens invade the nest of Formica fusca. Descriptive Characteristics: - Apex of gaster with semicircular to circular acidopore (easiest to see in smaller ants) - Postpetiole fused to gaster

By albany (153 views)

Subfamily Ponerinae

Subfamily Ponerinae

Subfamily Ponerinae. Compiled by Hilda Taylor. Genus Ectatomma. Genus Amblyopone. Genus Anochteus. Descriptive Characteristics: - Most species are very small - Closely related to Odontomachus - Head has smooth curve without nuchal carina - Mandibles elongate

By rruiz (0 views)

Subfamily Dolichoderinae

Subfamily Dolichoderinae

Subfamily Dolichoderinae. Compiled by Hilda Taylor. Genus Linepithema. Subfamily Dolichoderinae Descriptive Characteristic: Habitat: - Ants in this subfamily have reduced petiole, - All over the world the postpetiole is fused to the gaster

By azra (139 views)

ERF/AP2 Subfamily A3 and ERF/AP2 Subfamily A6 Genes: AT1G64380 and AT4G39780

ERF/AP2 Subfamily A3 and ERF/AP2 Subfamily A6 Genes: AT1G64380 and AT4G39780

ERF/AP2 Subfamily A3 and ERF/AP2 Subfamily A6 Genes: AT1G64380 and AT4G39780. ERF/AP2 DREB Subfamily. Characterized by AP2 domain AP2 family genes-shown to participate in regulation of embryo development Encodes putative transcription factors (DNA binding motif)

By daktari (157 views)

Mouse

Mouse

Mouse.

By kathy (81 views)

Country Mouse, City Mouse

Country Mouse, City Mouse

Country Mouse, City Mouse. Dear Country Mouse, Since you have never been to the big city, I’d like you to come to my place in Philadelphia for the weekend. There will be so many fun things to do. I can’t wait to see you! Love, City Mouse . Weekend in the Big City.

By aviva (191 views)

MOUSE

MOUSE

MOUSE. Done: Pashka Prybysh, 01025. First Mouse. The mouse was invented by Douglas Engelbart in 1964 and consisted of a wooden shell, circuit board and two metal wheels that came into contact with the surface it was being used on. Ball-style computer mouse. 1. Switch detects clicks of

By manton (305 views)

Mouse

Mouse

By gaura (129 views)

MOUSE

MOUSE

PROYECTO CEIBAL: C onectividad E ducativa de I nformática B ásica para el A prendizaje en L ínea. Partes de la computadora. CÁMARA. MICRÓFONO. PARLANTES. PARLANTES. TECLAS DE CONTROL DE JUEGO. PAD DE JUEGOS. BOTÓN DE ENCENDIDO. ROTACIÓN DE PANTALLA. MOUSE. ENCENDIDO DE LAS XO.

By jamese (166 views)