'Mrna sequence' diaporamas de présentation

2 nd Semester Review Edition !

626 views • 55 slides

Cloning and Sequencing Explorer Series Bioinformatics

700 views • 44 slides

Unit 4

612 views • 42 slides

Food, Facts and Fantasies: Can Your Diet Really Reduce Cancer Risk?

Food, Facts and Fantasies: Can Your Diet Really Reduce Cancer Risk? . J. A. Milner milnerj@mail.nih.gov. Nutrition Science Research Group Division of Cancer Prevention National Cancer Institute Bethesda, MD 20892.

800 views • 37 slides

GENETIC CODE

GENETIC CODE. FILE 8: POINT MUTATIONS. 1. In a mRNA sequence ( wt ) there is a triplet UUU. After a mutation, the triplet changes in UUA. What kind of mutation happened and which effects have the mutation on the protein encoded by the gene?.

368 views • 33 slides

Liquid Crystal Phases of DNA and Implications for the origin of life

Liquid Crystal Phases of DNA and Implications for the origin of life. Yang Yang, Xianfeng Song Advisor: Sima Setayeshgar Journal Club April 11 th , 2008. Outline. Part I: Introduction to liquid crystals Part II: Introduction to DNA Part III: Background on theories of origin of life

488 views • 29 slides

Tutorial 7

Tutorial 7. Genome browser. Genome browser. Free, open source, on-line browser for genomes Contains ~100 genomes, from nematodes to human. Many tools that can be used to analyze genomic data. Genome browser. http://genome.ucsc.edu/. How to find a gene of interest?. clade. genome.

435 views • 29 slides

12-3 RNA & Protein Synthesis

12-3 RNA & Protein Synthesis. Fill-in Notes. Genes are coded DNA instructions that control the production of proteins in the cell. Transcription. Translation. A Molecular Definition of Genes. Ribo nucleic acid Like DNA ( deoxyribo nucleic acid) EXCEPT: 1) 5-carbon sugar is ribose

248 views • 24 slides

a. Deletion of two nucleotides

1. A mutation occurs at the midpoint of a gene, altering all amino acids encoded after the point of mutation. Which mutation could have produced this change? A. Deletion of two nucleotides b. Deletion of three nucleotides c. Insertion of six nucleotides d. Insertion of twelve nucleotides.

367 views • 22 slides

10.4 Part C: Translation

10.4 Part C: Translation. Anticodons:. What and where? Function? Match to mRNA sequence: UUU CAA AGU UGA. Translation is. Monomers for a protein?. 5 steps:. 1. Initiation. 5 steps:. 2. Elongation. 5 steps:. 3. Elongation , cont. 5 steps:. 4. Termination.

263 views • 18 slides

Chapter 12: Protein Synthesis What is DNA?

Chapter 12: Protein Synthesis What is DNA?. Chapter 13 Protein Synthesis - Overview. The DNA of the gene is transcribed into RNA Which is translated into protein The flow of genetic information from DNA to RNA to Protein is called the CENTRAL DOGMA. DNA. Transcription. RNA.

392 views • 18 slides

RNA

RNA. Transcription, Translation and Protein Synthesis. Phosphate Group. O O=P-O O. Nitrogenous base (A, U , G, C ). 5. CH2. O. N. Sugar (ribose). C 1. C 4. C 3. C 2. RNA. RNA. Function: obtain information from DNA & synthesizes proteins.

310 views • 17 slides

The Role of Sphingolipids in Lipid Raft Function in Paramecium tetraurelia

The Role of Sphingolipids in Lipid Raft Function in Paramecium tetraurelia. Tyler Picariello 12/7/10. Outline. Background Model Organism Cilia and Lipid Rafts Methods Expected Results. Paramecium Background.

777 views • 15 slides

AUUCCGAUGGCAUUUUGCAAAUGAGAG

Identify the amino acids that make up the protein listed in the mRNA sequence below. AUUCCGAUGGCAUUUUGCAAAUGAGAG. Does the DNA sequence ever get messed up?. Yes, it does. When this happens, we call it a mutation.

243 views • 14 slides

A probabilistic approach to microRNA-target binding

A probabilistic approach to microRNA-target binding. Taylor Tsuboi. miRNA. short (22 nucleotide) RNA sequence present in eukaryotic cells post-transcriptional gene regulation bind to mRNA and generally result in translational repression and gene silencing.

272 views • 10 slides

Genome Sequencing & App. of DNA Technologies

Genome Sequencing & App. of DNA Technologies. Genomics is a branch of science that focuses on the interactions of sets of genes with the environment. Identification of Genes computer software scans for the existence of certain known features associated with genes start and stop sequences

271 views • 7 slides