'Promoter' diaporamas de présentation

Synthetic Biology

Synthetic Biology. A New Opportunity for Multidisciplinary Undergraduate Research. Jeff Poet, Laurie Heyer, Todd Eckdahl, Malcolm Campbell. 2010 G C A T Synthetic Biology Workshop Davidson College. Davidson - Missouri Western iGEM Collaboration. Focus on undergraduate education

1.1k views • 67 slides

TEST 3 FINAL REVIEW

TEST 3 FINAL REVIEW . Types of RNA. transcription. translation. mutations. Gene control. $100. $100. $100. $ 100. $100. $200. $200. $200. $200. $200. $300. $300. $300. $300. $300. $400. $400. $400. $400. $400. $500. $500. $500. $500. $500. FINAL ROUND.

677 views • 53 slides

CS5238 Combinatorial methods in bioinformatics

709 views • 53 slides

588 views • 47 slides

Bioinformatics for Vet. Part IX

Bioinformatics for Vet. Part IX. Sung Youn Lee, PhD. Student Veterinary collage, Room 320 02 450 3719, 016 293 6059 leevet@paran.com. Using the Nucleotide Sequence databases. The first sequence data bases is as sequence museum. Gene Bank

582 views • 45 slides

Living Hardware to Solve the Hamiltonian Path Problem

Living Hardware to Solve the Hamiltonian Path Problem. Professors : Dr. Malcolm Campbell and Dr. Laurie Heyer. Students : Oyinade Adefuye, Will DeLoache, Jim Dickson, Andrew Martens, Amber Shoecraft, and Mike Waters. The Hamiltonian Path Problem. Millennium Problem P=NP?

582 views • 44 slides

The DoOP database

519 views • 38 slides

Cell Biology I. Overview II. Membranes: How Matter Get in and Out of Cells

384 views • 32 slides

618 views • 19 slides

Cyprus University Entrepreneurship Competition July 2, 2009

Cyprus University Entrepreneurship Competition July 2, 2009. Sonicbids helps bands connect online with people who book or license music . Sonicbids Quick Facts. 200,000+. 47. MEMBER BANDS . FULL TIME EMPLOYEES . 18,000. $240,000 . PROMOTERS & LICENSORS. SEED CAPITAL IN 2001.

315 views • 19 slides

Fig. 17-17

Initiating translation. Large ribosomal subunit. 3 ?. U. 5 ?. C. A. P site. Fig. 17-17. Met. Met. 5 ?. 3 ?. A. G. U. Initiator tRNA. GDP. GTP. E. A. mRNA. 5 ?. 5 ?. 3 ?. 3 ?. Start codon. Small ribosomal subunit. Translation initiation complex. mRNA binding site.

869 views • 16 slides

Isolation and Characterization of the Metallothionein Promoter in Artemia

Isolation and Characterization of the Metallothionein Promoter in Artemia. Background. metallothionein = MT metal-binding protein four isoforms identified in mammals: MT-I, MT-II, MT-III and MT-IV diverse functions -metal ion homeostasis

563 views • 16 slides

Van aur Man ki kahaani

Van aur Man ki kahaani. Announcement not done properly Promoter gave the incomplete / incorrect spiel Promoter did not explain properly Consumer does not remember anything. What we did. Technology. Consumer Immersion Never Seen : Never Heard : Never Felt. OBD. Targeted by: Pincode

276 views • 14 slides

Eukaryotic Transcription

Eukaryotic Transcription. Eukaryotic Transcriptional. Transcription control is the most important mode of control in eukaryotes. Three RNA polymerases: RNA Polymerase I: synthesis of pre-rRNA, which is processed into 28S, 5.8S, and 18S rRNAs

503 views • 14 slides

Goals: Discuss 3 examples of transcriptional regulation Lac operon Coordinated gene regulation

Goals: Discuss 3 examples of transcriptional regulation Lac operon Coordinated gene regulation Regulation of transcription without regulation of polymerase. Gene expression can be regulated at any point between transcription and translation. Binding of pol II to the promoter Melting

367 views • 13 slides

Sport Facility & Event Management

Sport Facility & Event Management. Chapter 13. Types of Facilities. Single-Purpose Single-Purpose, Specified Multi-Purpose Nontraditional. Facility Management. Facility personnel Facility director/manager Operations manager Event coordinator Privatization Privatization Outsourcing

2.09k views • 10 slides

Bio Control Element

Bio Control Element. Presentation. BY Qing Ma, Qian Cong, Shao wenjun. Mar 2, 2008. Original Thought. Current Proposal. Potential Utility. Outline. Invention in iGEM should be biobrick with broadly usage. How to realize feedback (positive and negative).

255 views • 9 slides

Promoter

Confirmations. Venue. (Enter Venue). Promoter. (Enter Promoter). Count. (Enter Count). Menu. 1. Date. Name. Phone. Group. Confirm. 2. 3. 4. 5.

220 views • 1 slides

Relative Luciferase activity

TSP1. CT. VWC. IGFBP. C. N. *. *. *. *. *. *. *. *. *. *. *. *. *. *. *. *. *. *. *. *. *. *. AV E G D NCVF D GVIYRSG E KFQ P SCKFQCTCR D GQIGCV P RCQL D VLL P E P NC P A P RKV E V P G E CC E KWICG P DEED SLGGLTL. 14. +/-. -. +++. 12. 10.

118 views • 1 slides

- cloned from the anterior horn tissues

Primer S2. (A). (B). AGAAGCTGGAAGAGTCAAAG GACACATTCTCCCCTCAAGC CCCAGTGGGA. AGAAGCTGGAAGAGTCAAAG GACACATTCTCCCCTCAAGC CCCAGTGGGA. Breast (C).

86 views • 1 slides