'Read coverage' diaporamas de présentation

Informatics challenges and computer tools for sequencing 1000s of human genomes

565 views • 41 slides

Variation Detections and De novo Assemblies from Next-gen Data

530 views • 40 slides

Genome sequence assembly

Genome sequence assembly. Assembly concepts and methods Mihai Pop Center for Bioinformatics and Computational Biology University of Maryland. Building a library. Break DNA into random fragments (8-10x coverage). Actual situation. Building a library.

732 views • 30 slides

Bioinformatics for next-generation DNA sequencing

Bioinformatics for next-generation DNA sequencing. Gabor T. Marth Boston College Biology Department BC Biology new graduate student orientation September 2, 2008. Genetic code (DNA). AGCGT GGTAGCGCGAG TTTGCGAGCT AGCTAGGCT CCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT

515 views • 30 slides

ECE697S: Topics in Computational Biology

ECE697S: Topics in Computational Biology. Lecture 4: Sequence Assembly. Why Genome Sequencing?. Modern Sequencing Methods. Sanger (1982) introduced a sequencing method amenable to automation. Whole-genome sequencing: Clone-By-Clone vs. Shotgun Assembly

358 views • 25 slides

Dave Clements GMOD Help Desk National Evolutionary Synthesis Center (NESCent) clements@nescent

Visualising NGS data in GBrowse 2. Dave Clements GMOD Help Desk National Evolutionary Synthesis Center (NESCent) clements@nescent.org. August 2009 GMOD Meeting 6-7 August 2009. Overview. Visualizing Next Generation Sequence in GBrowse Using GBrowse with SAMtools as a short read viewer

412 views • 24 slides

FuzzyPath Assemblies - from Bacterial to Mammalian Genomes and Zebrafish Finishing

FuzzyPath Assemblies - from Bacterial to Mammalian Genomes and Zebrafish Finishing. Zemin Ning The Wellcome Trust Sanger Institute. Selexa reads assembler to extend long reads of 1-2Kb. forward-reverse paired reads. known dist. ~500 bp. 30-70 bp. 30-70 bp. Capillary reads assembler

312 views • 20 slides

FuzzyPath Assemblies - from Mixed Solexa /454 Datasets to Extremely GC Biased Genomes

FuzzyPath Assemblies - from Mixed Solexa /454 Datasets to Extremely GC Biased Genomes. Zemin Ning The Wellcome Trust Sanger Institute. Selexa reads assembler to extend long reads of 1-2Kb. forward-reverse paired reads. known dist. ~500 bp. 30-70 bp. 30-70 bp. Capillary reads assembler

315 views • 19 slides

A Hybrid Assembly System in Zebrafish Pooled Clones

A Hybrid Assembly System in Zebrafish Pooled Clones. Zemin Ning The Wellcome Trust Sanger Institute. Insert. extended long reads of 1-2Kb. ~300 bp. 30-75 bp. 30-75 bp. Solexa assembly. Genome/Chromosome Assembly. Solexa Reads. WGS Reads 5X. Fishing WGS Reads. FuzzyPath.

324 views • 16 slides