'Snp discovery' diaporamas de présentation

SNP Discovery and Analysis Application to Association Studies

SNP Discovery and Analysis Application to Association Studies. Mark J. Rieder, PhD Dana Crawford, PhD SeattleSNPs PGA Morehouse University May 2, 2005. Practical Aspects of SNP Association Studies. SNP Discovery: Where do I find SNPs to use in my association studies?

1.08k views • 88 slides

Gene Variations single nucleotides polymorphism & copy number variation

Gene Variations single nucleotides polymorphism & copy number variation. ??? ??????????????????? gfliu@stu.edu.cn 075488900497 13502932022. Genetic Variations. Chromosome numbers Segmental duplications, Copy number variation Translocations Inversion Sequence Repeats

2.84k views • 48 slides

MEDG 505 Pharmacogenomics March 17, 2005 A. Brooks-Wilson

542 views • 44 slides

Single Nucleotide Polymorphism

Single Nucleotide Polymorphism. Anshu Bhardwaj Research Fellow Centre for Cellular & Molecular Biology Hyderabad 8 th November, 2003. Single Nucleotide Polymorphism. Single base-pair differences occurring in a population with a frequency of >1%. ... C C A T T G A C.

1.25k views • 43 slides

What can we do with dairy cattle genomics other than predict more accurate breeding values?

What can we do with dairy cattle genomics other than predict more accurate breeding values?. Whole-genome selection (2008). Use many markers to track inheritance of chromosomal segments Estimate the impact of each segment on each trait

459 views • 33 slides

Bioinformatics for next-generation DNA sequencing

Bioinformatics for next-generation DNA sequencing. Gabor T. Marth Boston College Biology Department BC Biology new graduate student orientation September 2, 2008. Genetic code (DNA). AGCGT GGTAGCGCGAG TTTGCGAGCT AGCTAGGCT CCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT

515 views • 30 slides

Outline to SNP bioinformatics lecture

Outline to SNP bioinformatics lecture. Brief introduction SNPs in cell biology SNP discovery SNP assessment SNP databases SNPs in genome browsers. Single Nucleotide Polymorphisms. Must be present in at least 1% of the population

334 views • 24 slides

Outline to SNP bioinformatics lecture

Outline to SNP bioinformatics lecture. Brief introduction SNPs in cell biology SNP discovery SNP assessment SNP databases SNPs in genome browsers. Single Nucleotide Polymorphisms. Must be present in at least 1% of the population

462 views • 24 slides

Outline to SNP bioinformatics lecture

Outline to SNP bioinformatics lecture. Brief introduction SNPs in cell biology SNP discovery SNP assessment SNP databases SNPs in genome browsers. Single Nucleotide Polymorphisms. Must be present in at least 1% of the population

355 views • 24 slides

SNP Discovery in Whole-Genome Light-Shotgun 454 Pyrosequences

SNP Discovery in Whole-Genome Light-Shotgun 454 Pyrosequences. Aaron Quinlan 1 , Andrew Clark 2 , Elaine Mardis 3 , Gabor Marth 1. (1) Department of Biology, Boston College (2) Departments of Molecular Biology and Genetics, Cornell University

356 views • 22 slides

CAPTURING VALUE FROM SUPER-HIGH-OIL CORN --A partnership of Brownseed Genetics-BDI-UWRF/WiSys---

279 views • 16 slides

Gramene: Interactions with NSF Project on Molecular and Functional Diversity in the Maize Genome

Gramene: Interactions with NSF Project on Molecular and Functional Diversity in the Maize Genome Maize PIs (Doebley, Buckler, Fulton, Gaut, Goodman, Holland, Kresovich, McMullen, Stein, Ware). Maize Project Goals. Molecular Variation Sequencing survey of 1000 candidate loci

146 views • 14 slides

Polymorphism discovery informatics

Polymorphism discovery informatics. Gabor T. Marth. Department of Biology Boston College Chestnut Hill, MA 02467. Various insertion-deletion type polymorphisms (INDELs) are also very common. Types of sequence variations.

127 views • 12 slides

Fall 2014 HORT6033 Molecular Plant B reeding

Fall 2014 HORT6033 Molecular Plant B reeding. Instructor: Ainong Shi. HORT6033 web site: http://comp.uark.edu/~ashi/MB. Fall 2014 HORT6033 Molecular Plant Breeding Lecture 4 (09/03/2014). SNP SNP discovery by PCR Example Homework Question. Single Nucleotide Polymorphism (SNP).

439 views • 10 slides

Where We Started

Accelerating Genetic Improvement in Dairy Cattle in the Bovine Functional Genomics Laboratory (BFGL) and the Animal Improvement Programs Laboratory (AIPL) at BARC. Where We Are Today. Where We Started.

128 views • 1 slides