'Sql databases' diaporamas de présentation

Lecture 02: Conceptual Design

Lecture 02: Conceptual Design. Wednesday, October 6, 2010. Nulls. count(category ) != count(*) WHY ? Office hours: Thursdays, 5-6pm. Announcements. Homework 2 is posted: due October 19 th You need to create tables, import data: On SQL Server, in your own database, OR

1.07k views • 96 slides

NoSQL Data Stores Data Stores for the Cloud

979 views • 72 slides

Data visualization and graphic design Introducing R for data visualization

Data visualization and graphic design Introducing R for data visualization. Allan Just and Andrew Rundle EPIC Short Course June 21, 2011. Wickham 2008. Intro to R. Objectives After this class, participants will be able to: Describe some capabilities and uses of R

813 views • 57 slides

Top SharePoint 2013 Misconfigurations

702 views • 56 slides

Decoding the genome with perl, XML and SQL

Decoding the genome with perl, XML and SQL. Chris Mungall Howard Hughes Medical Institute UC Berkeley Lawrence Berkeley Lab. Outline. hacking the genome Data::Stag nested tag-value data and XML DBIx::DBStag Relational to XML mapping. CGACAATGCACGACAGAGGAAGCAGAACAGATATTTAGATTGCCTCTCAT

507 views • 42 slides

A Comparison of SQL and NoSQL Databases

ISO/IEC JTC1/SC32/WG2 N1537. A Comparison of SQL and NoSQL Databases. Keith W. Hare JCC Consulting, Inc. Convenor, ISO/IEC JTC1 SC32 WG3. Abstract.

1.28k views • 41 slides

A Comparison of SQL and NoSQL Databases

ISO/IEC JTC1/SC32/WG2 N1537. A Comparison of SQL and NoSQL Databases. Keith W. Hare JCC Consulting, Inc. Convenor, ISO/IEC JTC1 SC32 WG3. Abstract.

606 views • 41 slides

A Comparison of SQL and NoSQL Databases

ISO/IEC JTC1/SC32/WG2 N1537. A Comparison of SQL and NoSQL Databases. Keith W. Hare JCC Consulting, Inc. Convenor, ISO/IEC JTC1 SC32 WG3. Abstract.

565 views • 41 slides

WEKA

WEKA. Weka: the bird. Copyright: Martin Kramer (mkramer@wxs.nl) . Hamilton. WEKA: the software. W aikato E nvironment for K nowledge A nalysis Collection of state-of-the-art machine learning algorithms and data processing tools implemented in Java Released under the GPL

827 views • 36 slides

NoSQL

NoSQL. W2013 CSCI 2141. We can divide IT systems into transactional (OLTP) and analytical (OLAP). In general we can assume that OLTP systems provide source data to data warehouses, whereas OLAP systems help to analyze it. OLTP vs. OLAP. Challenges of Scale Differ.

646 views • 34 slides

NoSQL

NoSQL. W2013 CSCI 2141. We can divide IT systems into transactional (OLTP) and analytical (OLAP). In general we can assume that OLTP systems provide source data to data warehouses, whereas OLAP systems help to analyze it. OLTP vs. OLAP. Challenges of Scale Differ.

556 views • 32 slides

Education statistics in Sweden

439 views • 27 slides

Android/OpenMRS Forms/Protocols PeerSync

Android/OpenMRS Forms/Protocols PeerSync. Android/OpenMRS: initial goal. We want applications running on Android phone to save data for use in OpenMRS (for reporting, etc.) Easiest way is to use the same database. Data Model. OpenMRS uses MySQL Android has SQLite3

419 views • 25 slides

M1G505190 Introduction to Database Development

M1G505190 Introduction to Database Development. 1. Databases and Database Design. Teaching staff. Jim Paterson Room M628 James.Paterson@gcu.ac.uk Lab tutors: June McCrae Andreas Komninos Morteza Zanjireh Abbas Javed. Online resources. GCU Learn Announcements Assessment information

399 views • 25 slides

STATE of TECHNOLOGY

STATE of TECHNOLOGY. Sequim School District. External Connections. Connected to the State K20 Network Gigabet Ethernet Interface Current Contracted Rate is 100 Mb/s We routinely run at about 80 Mb/s Looking at increasing this capacity

270 views • 20 slides

Outline

Outline. SQL Server Optimizer Enumeration architecture Search space: flexibility/extensibility Cost and statistics Automatic Physical Tuning Database Tuning Advisor New Directions. Primary Index . Secondary Index. Running Example (TPC-H Database). Running Example (Query).

255 views • 13 slides

ACL Connections Recap

ACL Connections Recap . July 31, 2013 Jan Beckmann, CPA, ACDA. Overall Message. New leadership - Laurie Schultz, CEO Committed to improving ACL Analytics (desktop) New releases every 6 months with substantial enhancements Town hall meetings for user input. Conference Concepts.

328 views • 12 slides

FedEx

FedEx. SQL Report Builder & Misc. OverView. One Engine that can connect to ALL SQL databases. These reports can be placed in any page on any site. The Engine: http://dev-virt-sql-01/Reports / Example In Another Site: h ttp :// accountservices.bizzuka.com/reports/reportbuilder.asp.

317 views • 4 slides

From FITS to SQL Loading and Publishing the SDSS Data Ani Thakar and Alex Szalay (JHU), Jim Gray (Microsoft Research)

Load Monitor. Released June 2003, 1 Tbyte DBMS 85M photometric (image) objects 160k spectroscopic objects 2 versions of data: BEST and TARGET Relational Data Model (tables). Catalog data Catalog Archive Server (SkyServer) http://skyserver.pha.jhu.edu/dr1/.

13 views • 1 slides

Precision Authenticity

Precision Authenticity. Ellie Hughes Marketing Training. Tim Stopher Digital Marketing Web Build. Jude Stockley Account management Project management. Matthew Caldwell-Nichols Marketing Data Analysis.

133 views • 1 slides