sheba
Uploaded by
60 SLIDES
944 VUES
600LIKES

DNA Science

DESCRIPTION

DNA Science. MU Plant Genome Research Experience for Teachers Workshop. Friedrich Miescher. First to extract DNA from nuclei (1869). First to ID DNA as a distinct molecule. Source of DNA was white blood cells (WBC). WBCs are commonly found in infected wounds. Friedrich Miescher (cont.).

1 / 60

Télécharger la présentation

DNA Science

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. DNA Science MU Plant Genome Research Experience for Teachers Workshop

  2. Friedrich Miescher • First to extract DNA from nuclei (1869). • First to ID DNA as a distinct molecule. • Source of DNA was white blood cells (WBC). • WBCs are commonly found in infected wounds.

  3. Friedrich Miescher (cont.) • Called the substance he isolated nuclein. • It was high in phosphorus. • Thought main function was to store phosphorus.

  4. The Transforming Principle • Avery, Macleod, and McCarty (1943) discovered different strains of bacteria had different effects on a mouse.

  5. Transforming Principle (cont.) • What was the transforming principle from the dead virulent strain that made the avirulent strain lethal? • Separate the dead virulent strain into fractions and coinject with avirulent strain. • The DNA fraction contained the transforming principle. • Controversial result because at that time most scientists thought proteins were the hereditary material.

  6. Chargaff Principle • In 1950 found that whatever tissue he took DNA from the percentage of each nucleotide was the same. (%G = %C, %A = %T)

  7. Add Some Herstory to History! Early 1950’s: Rosalind Franklin, John Randall & Maurice Wilkins(King's College, London) made beautiful X-ray diffraction pictures of DNA fibers. Rosalind Franklin showed her DNA x-ray diffraction pictures to Watson and Crick. X-rays diffract X-ray source X-rays diffract

  8. “Mad Hatters Who Bubble Over About Their New Structure” Taken from G. Pomerat’s Diary (Apr 1953): “… Watson and Crick ….have got the structure of nucleic acid from a crystallographic rather than a chemical standpoint. Their clue came out of the beautiful x-ray diagrams produced in Randall’s lab… They are just putting the finishing touches on a huge model about six feet tall which shows that the molecule is made up of two helical chains…” DNA Double Helix, W&C Nature 1953 R. Franklin’s X-ray Picture http://vector.cshl.org/resources/pomerat.html

  9. Remembering Rosalind: British Award Honors Rosalind Franklin Watson and Crick publish Nature paper reporting DNA double helix (based in part on Rosalind’s DNA pictures) in 1953. Watson, Crick and Wilkins were awarded 1962 Nobel Prize for DNA double-helix. Rosalind Franklin was not awarded the Nobel Prize, she died in 1958 (37 years old) of ovarian cancer. The Franklin Medal now honors Rosalind’s critical role in the discovery of DNA double helix.

  10. 2003: 50 Year Anniversary of the Discovery of The DNA Double Helix The famous DNA Double Helix paper was published in Nature in 1953!

  11. The Double Helix • Two strands of DNA run in opposite directions, complementing each other and pairing with hydrogen bonds. • A and T pair together and C and G pair together. • Helix is most often right-handed (B-form).

  12. What Is DNA? DNA is a chemical contained in every cell of your body. Yes! DNA is a Chemical!? What other kinds of chemicals are in your body? • We are made up of chemicals, formed from the elements carbon • (C), hydrogen (H), oxygen (O), phosphate (P) and others • DNA is made up of carbon (C), hydrogen (H), oxygen (O), • phosphate (P) • We breathe air which contains oxygen molecules (O2). • We eat food which is composed of chemicals called proteins, • sugars, and fats. • Our bones are made up largely of calcium (Ca) • Our bodies make energy by breaking down chemicals such as • sugar! • We store energy in our body in the form of carbohydrate • chemicals.

  13. DNA • Hereditary material. • Contains all information to make proteins. • Linear polymer of nucleotide. • Each one has sugar, phosphate and a base.

  14. DNA • Base connected to sugar by β-glucosyl linkage. • Nucleotides are connected to one another by a phosphodiester bond. • Bases are perpendicular to helix.

  15. Four Bases • A=Adenine • T=Thymine • C=Cytosine • G=Guanine

  16. What Does DNA Look Like? • 3D DNA Helix Molecule • The spheres represent the actual positions • of atoms in the DNA molecule. • All the atoms together make up the entire • DNA molecule. • DNA molecule contains 2 DNA polymers • twisted around each other to make the DNA helix DNAHELIX (Tutorial)

  17. 3D DNA Double Helix: Two Long DNA Strands DNA Double Helix: Two DNA Strands Twisted Around Each Other “Green” DNA Strand “Red” DNA Strand

  18. 3D DNA Strands: Backbone DNA Strands: Each DNA Strand Contains OneBackbone and Building Block Bases Red DNA Strand Backbone Green DNA Strand Backbone DNA Backbones are Shown in Dark Green and Dark Red

  19. 3D DNA Strands: Building Blocks are DNA Letters Each DNA Strand Contains One Backbone and Many Building Block DNA Letters (Bases) Green Strand DNA Letters Red Strand DNA Letters “Green” DNA Strand “Red” DNA Strand DNA Letters: A, G, C, T

  20. How Does DNA Carry Information? • To answer this question we must take a closer look at DNA. • DNA is a biopolymer • Polymers are molecules made of repeating units or building blocks • DNA has four chemical building blocks symbolized by the letters A,G,C,& T • The letters of your DNA are in a specific order that carries information about you!! • So, a DNA polymer can be represented as a string of letters: A G C T T A G G G T A A A C C C A T A T A

  21. DNA Carries Information in the Sequence of DNA Letters . . .A G C T T A G G G T A A A C C C A T A G . . . A gene • A gene is a length of DNA letters that contain • an instruction for a cell to follow. • The cell uses specially designed protein machines • to read the information in genes.

  22. The Order of DNA Letters Encodes the Genetic Information The order or sequence of the A, G, C and T letters in the DNA polymer encodes the actual genetic information • Example of the DNA letters in a gene: • AGCTTAGGGTAAACCATATAGGGCCATACCCTATCGGTAAGCTT • AGCTTAGGGAAAACCCATATAGGGCCATACCCTATCGGTAAG • The specific order of the DNA letters carries • the information. • Changing the order of the DNA letters will change the information carried by the gene. • We will talk about how this happens later!

  23. Secret of DNA Fingerprinting Lies in the Ability to Detect Small Differences in DNA Letters Among Individual Samples • Look around the room and see how different we all look. Then compare any two human genomes: • The DNA letters are almost the identicalorder (sequence) between any two human genomes! • A very small number (0.1%) of the DNA letters differ between any two human genomes. • Two plants that look very • similar may be close or • distantly related because • humans select for desirable • traits in new varieties.

  24. Genes Can Have Hundreds to Millions of DNA Letters . . .A G C T T A G G G T A A A C C C A T A G . . . A gene It can take hundreds, thousands or even a million or more letters (bases) to “spell out” the instructions in a single gene. …and what for?

  25. Controlling Gene Expression • The specific order of DNA bases in a gene encode • a protein product. • Genes have START and STOP signals that specify • the length of the protein chain. • Control DNA region is in front of the “coding region” • and controls expression of the gene. GENE Control DNA region is called a promoter. DNA region carrying protein information is called the coding region. +1 PROTEIN CODING REGION PROMOTER mRNA

  26. Genes Contain Instructions for Building Proteins • Genes contain instructions for making proteins, one of the major types of the molecules of life, or “biomolecules” • Proteins, like DNA, are polymers • Protein building blocks are called amino acids • Amino acids are strung together into long, linear polymers by following the instructions in genes • In general, a gene encodes the instructions for one protein • When a gene is “misspelled,” the protein made from it • may be made with an incorrect amino acid • may not work properly

  27. Review of Gene Expression Pathway in Cells GENE DNA mRNA copy of gene mRNA goes to cytoplasm Ribosomes translate genetic information encoded in the mRNA into protein building blocks (chains of amino acids) Protein folds into 3D active structure Protein functions in cell Focus on the Genetic Code!

  28. DNA Code Is Copied into a “Portable” Code: mRNA RNA POLYMERASE (RNAP: COPIES DNA INTO mRNA) DNA DNA U A C A A T T G Note: DNA base-pairs between backbone strands are not shown here 3’ mRNA mRNA: AUGGAGUACUAAUAUGUAAAAAAAAAAAAAAAAAAA-3’ DNA: ATGGAGTACTAATATGT-3’ TACCTCATGATTATACA-5’ MFHMAF2001

  29. RNA Code has Different Alphabet Than DNA Code (RNA has U instead of T) DNA: ATGGAGTACTAATATGT-3’ TACCTCATGATTATACA-5’ 3’-TACCTCATGATTATACA-5’DNA STRAND AUGGAGUACUAAUAUGU mRNA copied from DNA DNA strand has “T” DNA Base-Pair RNA has U instead of T When DNA is copied into mRNA (transcription), U is incorporated into mRNA in place of T

  30. DNA Strands “Unzip” so the DNA Letters Can be “Read” -ATGGAGTACTAATATGT- -TACCTCATGATTATACA- -TACCTCATGATTATACA- AUGGAGUACUAAUAUGU mRNA copied from DNA -ATGGAGTACTAATATGT- +AUGGAGUACUAAUAUGU mRNA -TACCTCATGATTATACA- DOUBLE-STRANDED DNA (Region from Chromosome) DNA STRANDS SEPARATE DNA STRANDS COME BACK TOGETHER BY BASE-PAIRING mRNA GOES TO CYTOPLASM TO PROTEIN FACTORY DNA HELIX STAYS IN NUCLEUS

  31. Genetic Code is Written in 3-Letter DNA Words (Codons) -TACCTCATGATTATACA- DNA(DNA strands separated) -AUGGAGUACUAAUAUGU mRNA (copied from DNA) 5’-AUGGAGUACUAAUAUGU mRNA 5’-AUG GAG UAC UAA UAU mRNA mRNA code “read” by ribosome in TANDEM triplets called codons. Codon adaptors convert RNA letters into the correct amino acid building blocks in the protein chain. • CODON MEANINGS: • A “START PROTEIN” SIGNAL: AUG • A “STOP PROTEIN” SIGNAL: UAA, UGA, UAG • An amino acid building block of a protein • Codons identified in the Genetic Code Table

  32. The Universal Genetic Code Table STOP Codons: UAA UAG UGA Name of Building Block Amino Acid: Phe=Phenylalanine Leu=Leucine Ile=Isoleucine AUG CODON: Signal to start making the protein. http://anx12.bio.uci.edu/~hudel/bs99a/lecture20/lecture1_6.html

  33. N Met Glu Tyr C Genetic Code is Written in 3-Letter DNA Words -TACCTCATGATTATACA- DNA STRAND AUGGAGUACUAAUAUGU mRNA copied from DNA 5’-AUGGAGUACUAAUAUGU mRNA 5’-AUG GAG UAC UAA UAU mRNA Met-Glu-Tyr-STOP mRNA code is “read” in TANDEM CODONS A SHORT PROTEIN IS A PEPTIDE • CODON MEANINGS: • “START PROTEIN HERE”: AUG (START) Methionine (Met) • “STOP PROTEIN HERE”: UAA, UGA, UAG • Amino acid building blocks: N-Met-Glu-Tyr-C • Codons are identified in the Genetic Code Table

  34. N Met Glu Tyr C Proteins Have Two Ends: The N- And C- Termini 5’-AUGGAGUACUAAUAUGU mRNA 5’-AUG GAG UAC UAA mRNA Met-Glu-Tyr-STOP A short protein (peptide) has only a few amino acid (aa) building blocks. The first aa in the chain (usually Met) (AUG) is at the N-terminus. The final aa added to the chain is the C-terminus.

  35. Ribosome Protein Factory Reads the RNA Codons RNA is Copied From DNA (Gene) NUCLEUS GENE DNA UNZIPS mRNA Protein Synthesis Protein Chain Folds amino acid N AA Transfer RNA (tRNA): Matches mRNA codon with correct amino acid building block mRNA MFHMAF2001

  36. Legend Hates Water Likes Water Likes Water Likes Water • Proteins live in a watery environment (living organisms!). • Chemical parts that hate water fold on inside of protein. • Chemical parts that love water go to the outside surface of protein. • Surface of the folded protein interacts with proteins, DNA, RNA, etc. Proteins Fold into 3D Structures Polar “Pocket” Small Folded Protein C N Hydrophobic “Pocket”

  37. Different Protein Chains Fold to Make Proteinswith Different 3D Shapes and Biological Functions Protein #1 Protein #2 Protein #3 Protein #2 Protein #1 Human proteins have 20 different amino acid building blocks Protein #3

  38. Molecular Structures Related to Protein Function in the Cell DNA Intersection: Holliday Junction EF Hand Binds Calcium Basket “Syringe” Channel

  39. One Gene-One Protein • Archibald Garrod (1902) described alkaptonuria, a hereditary disorder as an “inborn error of metabolism”. • Proposed that mutations cause specific biochemical defects. • Alkaptonuria defect is dark urine.

  40. Spelling Mistake The DNA “word” TTC is changed to TTT A DNA Spelling Mistake Can Alter the Protein Chain START ADD ADD ADD ADD ADD ADD ADD STOP ATG TTC AGG CCA AAT TTT GTC GCG UAA GGA ATT ATG TTT AGG CCA AAT TTT GTC GCG TTC to TTT spelling change causes a different protein building block to be inserted in the second position. That is all it takes. ADD = Codon specifies the amino acid specified by 3-letter “word” ATG/AUG = Codon specifies start and methionine (met) UAA = STOP adding amino acids to protein chain

  41. A Mutation is a DNA “Spelling Mistake” • Mutant Genes Encode Defective Proteins: • (1)WILDTYPE(2)MUTANT • Example: AAA GCT ACC TAT AAA GCT ATC TAT • TTT CGA TGG ATA TTT CGA TAG ATA • Phe Arg Trp Ile Phe Arg Stop • UAG • PROTEIN: WT FUNCTIONNO FUNCTION • (1) Normal DNA and amino acid sequence makes a wild-type protein. • (2) Mutation in DNA changes Trp to Stop to make a short, mutant protein. • Mutations in DNA can be Caused by: • Mistakes made when the DNA is replicated (wrong base inserted) • Ultra violet (UV) light and ionizing radiation (X-rays) damage DNA • Environmental chemical carcinogens can damage DNA • Other factors DNA Technology: The Awesome Skill, I E Alcamo, Harcourt Academic Press, 2001

  42. Cell may not be able to follow damaged instruction OR Damaged protein is made OR Spelling error may be harmless X X Damaged protein may or may not be able to function in the cell. Cell does not make the protein Functional protein made by the cell Misspelled Genes: 3 Possible Outcomes DNA A misspelled gene

  43. DNA RNA DNA is Stored in the Nucleus (in Complex Cells) Complex cells have compartments, bacterial cells do not. Minimalist Complex Cell CELL MEMBRANE Controls entry and exit from cell NUCLEUS Cell Control Center- contains DNA, acivation of gene send RNA copies out into the cytoplasm. This is called gene expression. CYTOPLASMThe area and material inside the cell, but outside the nucleus and other comparments RIBOSOMESMake proteins from RNA instructions

  44. Every Cell Has a Complete Copy of Genome DNA: • Virtually every cell in your body contains its own complete copy of all your DNA • A single, complete copy of an organism’s DNA is called its genome • The genome is a set of instructions, like a master plan, written in a molecular language, using DNA instead of paper and ink • Therefore, each cell in your body has a copy of your genome, which is, in essence, a master plan for making you. But Most of My Cells Don’t Make Melanin-- Right?

  45. How BIG is 3.2 Billion DNA Letters? Human Genome • Human Genome Has 3.2 Billion • DNA Letters: 3,200,000,000 bp • 3.2 billion (3.2 x 109) is the same as: • 200 (1000 pages each) New York • City telephone books • 3 Gigabyte computer hard drive • a person typing 60 words/minute • for 8 hours/day, would take more than 50 years to type the entire human genome sequence • placed end-to-end the DNA in one • human cell extends almost 6 feet One DNA base-pair Genome Facts: NOVA Online Access Excellence Cell to Chromosome to DNA

  46. How Big are Plant Genomes? Plant Genome Human Genome Has 3.2 Billion DNA Letters: 3200 million bp Maize (Corn) Genome has 2.5 Billion DNA Letters: 2500 million bp Arabidopsis Genome has 125 million bp Rice Genome has 430 million bp Wheat Genome has 16,000 million bp One DNA base-pair

More Related