sienna
Uploaded by
16 SLIDES
586 VUES
200LIKES

DO NOW: (5 MINUTES)

DESCRIPTION

Topic: RELATIONSHIPS AND BIODIVERSITY LAB Aim : How do we gather evidences to determine the species related to Botana curus?. DO NOW: (5 MINUTES). NOTE : READ AND ANSWER THE QUESTIONS BELOW. AGENDA 03/04/09 DO NOW: Silent Reading MINI LESSON:

1 / 16

Télécharger la présentation

DO NOW: (5 MINUTES)

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Topic:RELATIONSHIPS AND BIODIVERSITY LABAim :How do we gather evidences to determine the species related to Botana curus? DO NOW: (5 MINUTES) NOTE: READ AND ANSWER THE QUESTIONS BELOW. • AGENDA • 03/04/09 • DO NOW: • Silent Reading • MINI LESSON: • Gathering structural Evidences to prove relationships • Formulating hypothesis • ACTIVITY: • Observing structural characteristics of Botana curus and species XYZ • REFLECTION • HOMEWORK • Castle Learning Botana curus is a valuable plant because it produces CUROL, a substance used to treat certain type of cancer. Curol is not produced in the laboratory. Botana curus rows very slowly and is on the endangered species List. Species that are most closely related to Botana curus might produce Curol. These 3 similar plant species are SPECIES X, SPECIES Y andSPECIES Z. One of them is closely related to Botana curus and could able to produce curol. QUESTIONS: 1. Why is Botana curus considered as a valuable plant? 2. What is curol? 3. What are the problems about Botana curus

  2. Topic:RELATIONSHIPS AND BIODIVERSITY LABAim :How do we gather evidences to determine the species related to Botana curus? • AGENDA • 12/18/0 • DO NOW: • Silent Reading • MINI LESSON: • Gathering structural Evidences to prove relationships • Formulating hypothesis • ACTIVITY: • Observing structural characteristics of Botana curus and species XYZ • REFLECTION • HOMEWORK • Castle Learning • AGENDA • 03/04/09 • DO NOW: • Silent Reading • MINI LESSON: • Gathering structural Evidences to prove relationships • Formulating hypothesis • ACTIVITY: • Observing structural characteristics of Botana curus and species XYZ • REFLECTION • HOMEWORK • Castle Learning MINI LESSON: (10 to 15 mins ) Botana curus is a valuable plant because it produces Curol, a compound used for treating certain kinds of cancer. Curol can not be produced in the laboratory. Botana curus grows very slowly and is on the endangered species list, so its ability to provide curol in large quantities is limited.

  3. Topic:RELATIONSHIPS AND BIODIVERSITY LABAim :How do we gather evidences to determine the species related to Botana curus? • AGENDA • 03/04/09 • DO NOW: • Silent Reading • MINI LESSON: • Gathering structural Evidences to prove relationships • Formulating hypothesis • ACTIVITY: • Observing structural characteristics of Botana curus and species XYZ • REFLECTION • HOMEWORK • Castle Learning • AGENDA • 12/18/08 • DO NOW: • Silent Reading • MINI LESSON: • Gathering structural Evidences to prove relationships • Formulating hypothesis • ACTIVITY: • Observing structural characteristics of Botana curus and species XYZ • REFLECTION • HOMEWORK • Castle Learning

  4. Topic:RELATIONSHIPS AND BIODIVERSITY LABAim :How do we gather evidences to determine the species related to Botana curus? TABLE 1: STRUCTURAL EVIDENCES • AGENDA • 12/18/08 • DO NOW: • Silent Reading • MINI LESSON: • Gathering structural Evidences to prove relationships • Formulating hypothesis • ACTIVITY: • Observing structural characteristics of Botana curus and species XYZ • REFLECTION • HOMEWORK • Castle Learning • AGENDA • 03/04/09 • DO NOW: • Silent Reading • MINI LESSON: • Gathering structural Evidences to prove relationships • Formulating hypothesis • ACTIVITY: • Observing structural characteristics of Botana curus and species XYZ • REFLECTION • HOMEWORK • Castle Learning

  5. Topic:RELATIONSHIPS AND BIODIVERSITY LABAim :How do we gather evidences to determine the species related to Botana curus? • AGENDA • 03/04/09 • DO NOW: • Silent Reading • MINI LESSON: • Gathering structural Evidences to prove relationships • Formulating hypothesis • ACTIVITY: • Observing structural characteristics of Botana curus and species XYZ • REFLECTION • HOMEWORK • Castle Learning • AGENDA • 12/18/08 • DO NOW: • Silent Reading • MINI LESSON: • Gathering structural Evidences to prove relationships • Formulating hypothesis • ACTIVITY: • Observing structural characteristics of Botana curus and species XYZ • REFLECTION • HOMEWORK • Castle Learning Structural Characteristic of Plants

  6. Topic:RELATIONSHIPS AND BIODIVERSITY LABAim :How do we gather evidences to determine the species related to Botana curus? • AGENDA • 03/04/09 • DO NOW: • Silent Reading • MINI LESSON: • Gathering structural Evidences to prove relationships • Formulating hypothesis • ACTIVITY: • Observing structural characteristics of Botana curus and species XYZ • REFLECTION • HOMEWORK • Castle Learning • AGENDA • 12/18/08 • DO NOW: • Silent Reading • MINI LESSON: • Gathering structural Evidences to prove relationships • Formulating hypothesis • ACTIVITY: • Observing structural characteristics of Botana curus and species XYZ • REFLECTION • HOMEWORK • Castle Learning Structural Characteristic of Seeds

  7. Topic:RELATIONSHIPS AND BIODIVERSITY LABAim :How do we gather evidences to determine the species related to Botana curus? Compare Stem Structures • AGENDA • 03/04/09 • DO NOW: • Silent Reading • MINI LESSON: • Gathering structural Evidences to prove relationships • Formulating hypothesis • ACTIVITY: • Observing structural characteristics of Botana curus and species XYZ • REFLECTION • HOMEWORK • Castle Learning Microscopic Stem Structure- SCATERRED OR CIRCULAR? • AGENDA • 12/18/08 • DO NOW: • Silent Reading • MINI LESSON: • Gathering structural Evidences to prove relationships • Formulating hypothesis • ACTIVITY: • Observing structural characteristics of Botana curus and species XYZ • REFLECTION • HOMEWORK • Castle Learning Botana curus Species X Species Y Species Z

  8. Topic:RELATIONSHIPS AND BIODIVERSITY LABAim :How do we gather evidences to determine the species related to Botana curus? HYPOTHESIZE: TESTS 1-3 • AGENDA • 03/04/09 • DO NOW: • Silent Reading • MINI LESSON: • Gathering structural Evidences to prove relationships • Formulating hypothesis • ACTIVITY: • Observing structural characteristics of Botana curus and species XYZ • REFLECTION • HOMEWORK • Castle Learning Formulating Hypothesis • AGENDA • 12/18/08 • DO NOW: • Silent Reading • MINI LESSON: • Gathering structural Evidences to prove relationships • Formulating hypothesis • ACTIVITY: • Observing structural characteristics of Botana curus and species XYZ • REFLECTION • HOMEWORK • Castle Learning A.Base on your data for structural relationships, which species ( X,Y,Z) would you hypothesize is most likely to produce CUROL? __________ B. Explain how the evidence from your data table supports your hypothesis.

  9. Topic:RELATIONSHIPS AND BIODIVERSITY LABAim :How do we gather evidences to determine the species related to Botana curus? TABLE 1: MOLECULAR EVIDENCES • AGENDA • 03/04/09 • DO NOW: • Silent Reading • MINI LESSON: • Gathering structural Evidences to prove relationships • Formulating hypothesis • ACTIVITY: • Observing structural characteristics of Botana curus and species XYZ • REFLECTION • HOMEWORK • Castle Learning • AGENDA • 12/18/08 • DO NOW: • Silent Reading • MINI LESSON: • Gathering structural Evidences to prove relationships • Formulating hypothesis • ACTIVITY: • Observing structural characteristics of Botana curus and species XYZ • REFLECTION • HOMEWORK • Castle Learning

  10. Topic:RELATIONSHIPS AND BIODIVERSITY LABAim :How do we gather evidences to determine the species related to Botana curus? TEST # 4: Paper Chromatography • AGENDA • 03/04/09 • DO NOW: • Silent Reading • MINI LESSON: • Gathering structural Evidences to prove relationships • Formulating hypothesis • ACTIVITY: • Observing structural characteristics of Botana curus and species XYZ • REFLECTION • HOMEWORK • Castle Learning

  11. Topic:RELATIONSHIPS AND BIODIVERSITY LABAim :How do we gather evidences to determine the species related to Botana curus? Testing for “M” Species Y Species Z Species X Botana curis Record the results of your tests for enzyme “M” (either a Positive or Negative result) in Table 1

  12. Topic:RELATIONSHIPS AND BIODIVERSITY LABAim :How do we gather evidences to determine the species related to Botana curus? Base Pair Rule GAA GGA CTC DNA : GCAT CTT CCT GAG GTG GTA CAC RNA : GCAU GUG CAC CAU

  13. Topic:RELATIONSHIPS AND BIODIVERSITY LABAim :How do we gather evidences to determine the species related to Botana curus? Translating DNA Code to Make Proteins BOTANA CURUS CAC GTG GAC TGA GGA CTC CTC Sequence of bases in mRna Produced ______________________________ Sequence of amino Acids in the protein _______________________________ GUG CAC CUG ACU CCU GAG GAG VAL HIS LEU THR PRO GLU GLU

  14. Topic:RELATIONSHIPS AND BIODIVERSITY LABAim :How do we gather evidences to determine the species related to Botana curus?

  15. Topic:RELATIONSHIPS AND BIODIVERSITY LABAim :How do we gather evidences to determine the species related to Botana curus? Gel Electrophoresis Separation of DNA Fragments

  16. GEL ELECTROHORESIS BANDING PATTERN BC: ATTCCGGATCGATCGCCGGATATACTCCGGTTATATC 5- 12- 11- 9 X : ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA 8- 7- 22 Y : ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC 3 5 12- 17 Z : ATTCCGGATCGATCGCCGGATATACTCCGGTTATATC 5- 12- 11- 9

More Related