70 likes | 250 Vues
Is there a correlation between similar cluster phages’ tandem repeats within the tape measure protein and its location within that gene?. Jonathan Kindberg BNFO 301 04/24/2013. Tape Measure Protein.
E N D
Is there a correlation between similar cluster phages’ tandem repeats within the tape measure protein and its location within that gene? Jonathan Kindberg BNFO 301 04/24/2013
Tape Measure Protein • Tail of a phage is used to inject it’s DNA into the host bacterium, which is the beginning of lysis. • The tape measure protein got its name because the length of the corresponding gene is proportional to the length of the phage's tail: a fact shown by actually copying or splicing out parts of DNA in exemplar species [1]. • Tandem Repeats are the tell tale sign of the tape measure protein
Tandem Repeats • Tandem repeats occur when more than one nucleotide is repeated • The nucleotide repeats lie adjacent to each other within the gene. • TR example: ATGTAAGCTAAGCTAAGCTTG • The tandem repeat consists of TAAGC
Experimental Procedure • Phagesdb.org to look at similar cluster phages • Look for tandem repeats in he genomes to find the tmp gene with the use of PhAnToMe/BioBIKE • PhAnToMe/BioBIKE functions will include SEQUENCE-SIMILAR-TO and ALIGNMENT-OF • Scatter plot of the phages tandem repeats vs. location in their genome will be graphed • Analysis of experimental findings
Experimental Tools • Phagesdb.org • PhAnToMe/BioBIKE • Tandem Repeat Finder • Blast • Oracle Virtual Machine • Allows me to find phamerator maps of annotated phages.
Results • TBD
References • The evolution of the tape measure protein: units, duplications and losses: Belcaid M, Bergeron A, Poisson G. BMC Bioinformatics. 2011 Oct 5;12 Suppl 9:S10. doi: 10.1186/1471-2105-12-S9-S10.http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3271669/ • Length Determination in Bacteriophage Lambda Tails. Katsura, I and Hendrix, R. Cell, Vol . 39, 691-698, December 1984. http://ac.els-cdn.com/0092867484904768/1-s2.0-0092867484904768-main.pdf?_tid=46972fa4-9c69-11e2-b6bc-00000aab0f26&acdnat=1364998854_34031474c286eed57d3f1aadfd1a1d92 • Mechanism of Length Determination in Bacteriophage Lambda Tail. Katsura, Isao. Department of Biology, College of Arts and Sciences, The University of Tokyo, Meguro-ku, Tokyo 153, Japan. Adv. Biophys., Vol. 26, pp. 1-18 (1990).