synclair
Uploaded by
73 SLIDES
1295 VUES
790LIKES

Human Genetics Basics

DESCRIPTION

Human Genetics Basics. Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu. Syndrome named after an old guy Gene name, which is some meaningless abbreviation Pathway Genetic test. Medical Genetics. Variable Human Traits. Qualitative Traits:

1 / 73

Télécharger la présentation

Human Genetics Basics

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu

  2. Syndrome named after an old guy Gene name, which is some meaningless abbreviation Pathway Genetic test Medical Genetics

  3. Variable Human Traits Qualitative Traits: Discrete traits Receding hairline Bushy eyebrows Gray hair Quantitative Traits: Measurable traits IQ Blood pressure Height

  4. genetic environmental Genes versus Environment Rare Simple genetics High recurrence risk Common Complex genetics Low recurrence risk Sickle cell disease Hypertension Heart disease Diabetes Asthma Behavioral disorders Scurvy; Infectious diseases; Gunshot wound

  5. Why might someone want to seek genetic services? • Get information about their family history and any genetic risk factors • The diagnosis of a genetic disorder by physical examination and/or genetic laboratory testing • How/why a disorder occurred (in most cases) • The chance for the disorder to reoccur in the family • The chance for other family members to have the disorder or pass it on • The management and treatment of the disorder • Support groups for the disorder • Connections to other families who have a child with a similar/same disorder

  6. Types of genetic testing 1. Diagnostic testing - establish or confirm a diagnosis 2. Carrier testing - screen adults to determine if they are carriers of mutations so that their risk of having a child with a genetic defect can be calculated 3. Prenatal testing - determine if a fetus is affected with a genetic disorder (also includes PGD testing). 4. Presymptomatic testing - determine if a currently asymptomatic individual will become affected with a genetic disease in the future. 5. Population screening - screening of the entire population for a genetic disorder so that these individuals can be identified and treated before the onset of symptoms

  7. Karyotype 23 pairs autosomes, 2 sex chromosomes Each chromosome has a characteristic banding pattern What is the most common genetic variation you see in karyotypes from a normal population? Chromosome Variation 46, XX versus 46, XY

  8. Variation in Chromosome Number • Trisomies 13, 18, and 21 are the only non-mosaic trisomies for an entire autosome that are compatible with postnatal survival • Monosomy X is the only monosomy that is viable Trisomy 13 Trisomy 18 Turnpenny & Ellard, 2007

  9. Variation in chromosome structure • Translocations • Inversions • Duplications • Deletions

  10. Chromosome abnormalities microscopically visible changes in the number or structure of chromosomes occur in: Approximately 1% of all live births 23% of congenital anomalies with MR 13% of congenital heart defects 60% of spontaneous first trimester abortions Examples: • Down syndrome - caused by an additional copy of chromosome 21 • Unbalanced translocations - partial monosomy for one region of the genome and partial trisomy for another region of the genome • 22q11.2 deletion –interstitial deletion of 3Mb removing several genes

  11. When to order cytogenetic testing (i.e. standard of care) Multiple congenital anomalies Mental retardation of unknown origin or associated with minor or major malformations Multiple unexplained spontaneous abortions Ambiguous genitalia Prenatal testing Abnormal prenatal screen Ultrasound abnormalities

  12. Fluorescence In Situ Hybridization (FISH) G A T T Denatured probe DNA Metaphase cell Denatured target DNA ds ssDNA

  13. FISH probes Unique sequence probes - single copy probes (1 kb feasible). Useful for microdeletions/dups, specific telomeres. A shows a normal chromosome 15 B shows a deletion at the end of the other chromosome 15

  14. Copy Number Polymorphism • Large chunks of DNA (1000s-1 Mb) that are present in a variable number of copies in different people • Can affect the number of copies of a gene that are present in a person • Even if they don’t contain a complete gene, they can affect the level of gene expression

  15. Fragments of sample and reference DNA labeled with different fluorescent dyes Labeled DNAs are denatured and incubated with metaphase chromosomes or on DNA arrays The DNAs compete for binding to the target DNA Resulting relative fluorescence is measured If there’s an equal sequence between sample and reference,you get a yellow signal. If not you get red or green. Comparative Genome Hybridization

  16. Indications for array CGH • Patients with normal chromosome analysis and: • Unexplained developmental delay or mental retardation • Dysmorphic features or congenital anomalies • Autism spectrum disorders, seizures, or a clinical presentation suggestive of a chromosomal syndrome • Patients with a previously identified chromosome abnormality: • To size deletions or duplications and identify genes involved • For apparently balanced rearrangements and an abnormal clinical phenotype, oligo array analysis can be used to test for cryptic deletions/duplications at the breakpoints

  17. Changes to DNA sequence CTCGAGGGGCCTAGACATTGCCCTCCAGAGAGAGCACCCAACACCCTCCAGGCTTGACCGGCCAGGGTGTCCCCTTCCTACCTTGGAGAGAGCAGCCCCAGGGCATCCTGCAGGGGGTGCTGGGACACCAGCTGGCCTTCAAGGTCTCTGCCTCCCTCCAGCCACCCCACTACACGCTGCTGGGATCCTGGATCTCAGCTCCCTGGCCGACAACACTGGCAAACTCCTACTCATCCACGAAGGCCCTCCTGGGCATGGTGGTCCTTCCCAGCCTGGCAGTCTGTTCCTCACACACCTTGTTAGTGCCCAGCCCCTGAGGTTGCAGCTGGGGGTGTCTCTGAAGGGCTGTGAGCCCCCAGGAAGCCCTGGGGAAGTGCCTGCCTTGCCTCCCCCCGGCCCTGCCAGCGCCTGGCTCTGCCCTCCTACCTGGGCTCCCCCCATCCAGCCTCCCTCCCTACACACTCCTCTCAAGGAGGCACCCATGTCCTCTCCAGCTGCCGGGCCTCAGAGCACTGTGGCGTCCTGGGGCAGCCACCGCATGTCCTGCTGTGGCATGGCTCAGGGTGGAAAGGGCGGAAGGGAGGGGTCCTGCAGATAGCTGGTGCCCACTACCAAACCCGCTCGGGGCAGGAGAGCCAAAGGCTGGGTGTGTGCAGAGCGGCCCCGAGAGGTTCCGAGGCTGAGGCCAGGGTGGGACATAGGGATGCGAGGGGCCGGGGCACAGGATACTCCAACCTGCCTGCCCCCATGGTCTCATCCTCCTGCTTCTGGGACCTCCTGATCCTGCCCCTGGTGCTAAGAGGCAGGTAAGGGGCTGCAGGCAGCAGGGCTCGGAGCCCATGCCCCCTCACCATGGGTCAGGCTGGACCTCCAGGTGCCTGTTCTGGGGAGCTGGGAGGGCCGGAGGGGTGTACCCCAGGGGCTCAGCCCAGATGACACTATGGGGGTGATGGTGTCATGGGACCTGGCCAGGAGAGGGGAGATGGGCTCCCAGAAGAGGAGTGGGGGCTGAGAGGGTGCCTGGGGGGCCAGGACGGAGCTGGGCCAGTGCACAGCTTCCCACACCTGCCCACCCCCAGAGTCCTGCCGCCACCCCCAGATCACACGGAAGATGAGGTCCGAGTGGCCTGCTGAGGACTTGCTGCTTGTCCCCAGGTCCCCAGGTCATGCCCTCCTTCTGCCACCCTGGGGAGCTGAGGGCCTCAGCTGGGGCTGCTGTCCTAAGGCAGGGTGGGAACTAGGCAGCCAGCAGGGAGGGGACCCCTCCCTCACTCCCACTCTCCCACCCCCACCACCTTGGCCCATCCATGGCGGCATCTTGGGCCATCCGGGACTGGGGACAGGGGTCCTGGGGACAGGGGTCCGGGGACAGGGTCCTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTCCGGGGACAGGGGTGTG ~ 1 change every 1,000 bases = 99.9% identical from person to person

  18. ½ White Lily chocolate What is the effect of a DNA change?

  19. No change DNA change can lead to different results ??? Deleterious polymorphisms mutation Neutral variation height, weight response to certain drugs, hair, skin, eye color Inborn errors of metabolism, cystic fibrosis, sickle cell anemia, cancer

  20. Mutation can occur in different places across a gene 1 2 3 4 5 X X X X promoter

  21. Clinicians often don’t use pedigrees • “Although there are several obstacles, ... a common underestimation by clinicians of the value of the family history, …” Blue – 57% - no significant family hx Red – 33% - one chronic condition Yellow – 8% - two Pink – 2% - three or more (3) Scheuner, et al. Am J Med Genet 1997, 71:315-324.

  22. Pedigree vs. Questionnaire • Focus on individuals by asking about each person in family • Trigger patient memory • Easier to see patterns • Use to explain patterns • Demonstrates biological relationships • “Amount of genetic information shared” • Reveals social relationships

  23. Family history can provide the basis for: • Making a diagnosis • Determining who is at risk and level of risk • Assessing needs for education and psychosocial support

  24. Rules • Squares for males • Circles for females • Relationship line (horizontal) – connects partners – double slash equals separation • Line of descent (vertical) • Sib-ship line (horizontal)

  25. d. 58 Colon CA Information to collect • Initials or first name – particularly affected • Ages or dates (year) of birth • Decades for adult onset concerns okay • Unaffected just as important as affected • If affected, note age of onset • Deceased – slash – age and cause – include lost pregnancies

  26. More information to collect • Physical and mental health of each individual • Birth defects, developmental delay, mental retardation, inherited disorders, chronic conditions? • Build key – shading, patterns, etc. • Watch abbreviations – add to key as you go • Date pedigree, Where and who collected • Who reported information - Historian

  27. Mental retardation/ developmental delay Birth Defects Obvious genetic conditions Infertility/miscarriage Early age of onset Multiple affecteds Individuals who are affected multiple times Particular constellations of features Pattern of inheritance What to look for:

  28. 90 82 Dx 48 d. 50 82 63 60 62 Dx 42 58 61 Type 2 diabetes Dx. 45 28 35 33 30 Breast cancer

  29. 90 82 Dx 75 d. 77 Dx 76 80 Dx 68 d. 75 MI 63 60 62 58 28 35 33 30 Breast cancer

  30. 90 d. 86 Prostate ca d. 35 Car accident Dx 54 d. 78 70 63 60 d. 40 MI 58 Dx 51 51 28 35 33 30 Breast cancer

  31. Autosomal Dominant • Responsible gene on autosome • Only 1 copy of mutation needed - normal allele not sufficient to compensate for mutant allele • Heterozygotes and homozygotes are both affected

  32. Characteristics of Autosomal Dominant Disorders • appears in every generation • each affected person has an affected parent (exceptions!) • each child of an affected parent has 50% risk to inherit trait. • unaffected family members don’t transmit phenotype to children (exceptions again). • males and females equally likely to transmit the trait, to children of either sex. • male-to-male transmission • new mutations relatively common

  33. Aa Aa aa Autosomal Recessive • Responsible gene on autosome • Both alleles of the gene must be defective. • Frequently due to loss of function (gene is inactivated) • Heterozygotes are unaffected carriers Medium chain acyl CoA dehydrogenase (MCAD)

  34. Characteristics of Autosomal Recessive Disorders • If disorder appears >1 family member, typically found within a sibship, not across generations. • The recurrence risk for each sib of the proband is 25%. • More common with consanguinity, especially for rare diseases. • Males and females are equally likely to be affected. • New mutation is almost never a consideration.

  35. Sex-Linked • Responsible gene on X chromosome (also called “X-linked”) • Usually for females, both copies of the X chromosome must be affected • Males, hemizygous for the X chromosome, much more likely to be affected X-linked mental retardation

  36. Diagnostic Tests Chorionic Villus Sampling (CVS) Amniocentesis Testing for single gene defects Screens Combined first trimester screen Triple screen/Quad screen Genetics and Prenatal Care

  37. Diagnostic Tests Chorionic Villus Sampling (CVS) Amniocentesis Screens Combined first trimester screen Triple screen/Quad screen Genetics and Prenatal Care Is 35 a “magic” age cut-off for screening versus testing?

  38. From Thompson & Thompson Genetics in Medicine

  39. For an autosomal recessive disorder, what is the family history likely to be?

  40. Carrier Testing The frequency of Tay-Sachs (prior to the onset of widespread carrier screening among Ashkenazim ) was about: 1/360,000 live births for non-Ashkenazi North Americans, and 1/3,600 for North American Ashkenazi Jews Carrier frequencies are therefore about: 1/300 for most North Americans, and 1/30 for North American Ashkenazi Jews And within a certain population, particular mutations tend to predominate

  41. African Americans: Sickle cell disease 1 in 10 Caucasians: Cystic fibrosis 1 in 25 Ashkenazi Jewish: Tay-Sachs Canavan Disease 1 in 40 Gaucher Disease 1 in 13 Familial Dysautonomia 1 in 30 Cystic fibrosis 1 in 25 Fanconi anemia 1 in 90 Niemann-Pick Disease 1 in 90 Bloom syndrome 1 in 100 Carrier Testing What does a negative result tell you?

  42. For an autosomal recessive disorder, what is the family history likely to be?

  43. Newborn Screening

  44. Newborn Screening: WHY ? • Detect an affected infant before before symptoms to prevent or reduce morbidity and mortality • Provide parents and family reproductive options for future pregnancies • Avoid diagnostic odyssey

  45. http://genes-r-us.uthscsa.edu

  46. www.acmg.net/resources Look under “reference materials”

  47. Algorithm for MCAD positive newborn screen

  48. MCAD ACT Sheet

  49. Adults who might seek genetic services: • Those with reproductive problems • Those with a known genetic disorder in the family • Those with symptoms of a genetic disorder • Those with family history of cancer

  50. Case Study • At the time of her annual physical, your patient, a 30-year old woman, asks about the “breast cancer gene”. She is Jewish and has been reading in the paper that Jewish women may be more likely to have this “gene”. She has two older sisters, aged 33 and 35, who are also worried about their risks.

More Related