Genetics and Inheritance
Genetics and Inheritance. How do you relate these two terms?. Genetics . Is the study of heredity or the passing of traits from one generation to the next. WOTD: Homo zygous - same. 1. Assign a letter to a trait. TRAIT LETTER Flower color R.
Genetics and Inheritance
E N D
Presentation Transcript
Genetics and Inheritance How do you relate these two terms?
Genetics • Is the study of heredity or the passing of traits from one generation to the next.
WOTD: Homozygous - same 1. Assign a letter to a trait. TRAITLETTER Flower color R 2. Pink is the dominant color so use a big R 3. White is the recessive color so use a small r. 4. RR = HOMOZYGOUS DOMINANT (you see the dominant color)5. rr = HOMOZYGOUS RECESSIVE (you see the recessive color)
What is Dominant(R) vs. Recessive(r)? Dominant (R) – only one of the genes needs to be present for it to be expressed (become the phenotype). ONLY rr = RR = Rr = Recessive (r) – both genes must be present in order for this version of the gene to be expressed.
WOTD: Heterozygous = different 1. Rr = HETEROZYGOUS DOMINANT 2. RR = ? 3. rr = ? 4. Can we have HETEROZYGOUS RECESSIVE??
Answer these questions If the trait HEIGHT has the dominant gene of TALL and the recessive gene of SHORT. What genotypes would you assign the following people (hint: one is not possible)? 1. Bart is heterozygous Tall. 2. Marge is homozygous Tall. 3. Homer is homozygous Short. 4. Maggie is heterozygous Short. 1. Hh 4. NOT POSSIBLE ;o) 2. HH 3. hh
THIS IS A PUNNETT SQUARE FOR A • HETEROZYGOUS DOMINANT (Rr) AND A Punnett Square r R 2. HOMOZYGOUSRECESSIVE (rr) CROSS. r r HOW DO YOU THINK WE SHOULD FILL IN THE SQUARES?
SET UP THE FOLLOWING PUNNET SQUARE • Heterozygous Dominant crossed with Heterozygous Dominant. 2. What is the percentage of Dominant and recessive phenotypes (what you see)?
Dihybrid Cross RYRyrYry A cross involving two traits (texture and color). Round = RR Wrinkled = rr Yellow = YY Green = yy Crossing 2 Heterozygous peas that are both Round and Yellow would have the genetic code RrYy x RrYy RY Ry rY ry
Co-dominance • Condition where BOTH alleles for a trait in an individual are expressed (PHENOTYPE). THE DOMINANT ALLELE IS RED THE RECESSIVE ALLELE IS WHITE THE OFFSPRING WILL SHOW BOTH AND BE RED AND WHITE!
Incomplete Dominance A BLEND of two different traits. x = WHITE FLOWER PINK FLOWER RED FLOWER
Incomplete Dominance A BLEND of two different traits. Ex. Hazel color eyes x = GREEN EYED DOG HAZEL EYED DOG BROWN EYED DOG
ANSWER THESE QUESTIONS Choose one of these answers for each question PLUS tell me if it is a DOMINANT or RECESSIVE phenotype. A.Regular B.CodominanceC.Incomplete Dominance 1. A red flower and a white flower make a red flower. 2. A red flower and a white flower make a white flower. 3. A red flower and a white flower make a red and white flower. 4. A red flower and a white flower make a pink flower.
Multiple Alleles • Three or more alleles for the same trait for instance the A,B,O blood groups.
Cystic Fibrosis • A recessive genetic disorder caused by the mutation in the gene that codes for a protein responsible for transporting chloride ions.
Down Syndrome • An example of a genetic disorder caused by an extra chromosome in pair number 21.
A neurological disorder that leads to progressive degeneration of brain cells. Huntington’s Disease is a recessive allele. Right is a pedigree that shows a family passing this trait. Huntington’s Disease • 7. What would be the phenotype and genotype of family member #7? • HH, Huntington’s b. Hh, Huntington’s • c. hh, No Huntington’s d. Hh, No Huntington’s • 8. Which genotype is not possible for family members #11 and #12? • a. HH b. Hh c. hh • d. All of these are possible White = Huntington’s (h) Black = No Huntington’s (H) Half = No Huntington’s (Hh) NUMBER FAMILY MEMBERS AND ASSIGN ALLELE STATUS.
GENETIC ENGINEERING AND CLONING HELLO! MY NAME IS GENE AND I’M HERE TO TALK TO YOU ABOUT…..
Make a K-W-L chart for each term Genetic EngineeringWhat do I Know Want to Know Learned 1. 2. 3.
Make a K-W-L chart for each term CLONINGWhat do I Know Want to Know Learned 1. 2. 3. WHAT IS NT? DRAW A PICTURE
HAVE YOU HEARD ABOUT A SHEEP NAMED DOLLY? WHY IS SHE FAMOUS?? WHAT ABOUT THOSE TOMATOES THAT STAY FRESH SO MUCH LONGER? WHICH EXAMPLE IS CLONING AND WHICH ONE IS GENETIC ENGINEERING?
Genetic engineering, in its broadest definition, means to manipulate a species so that a particular trait is increased in the population. A trait is how an organism looks or acts or what it does. Brown eyes is a trait. Flying in circles is a trait. Climbing trees is a trait. "The earliest forms of genetic engineering occurred on farms, where most people on earth lived at the time. They managed to do this by selecting seeds from plants that maybe had more fruit production or tastier leaves than other plants of its type.
Genetic Engineering: The Controversy Genetic engineering of the human food supply is a highly contentious issue, with credentialed scientists arguing on each side. Most likely the controversy will continue. The effort by biotech companies to genetically modify food will continue to increase and resistance by consumers to genetically modified food will continue to grow. Overview PRO: Genetic engineering is a valuable new technology that can develop more plentiful and nutritious foods, with great potential benefits for humanity and the environment, and this new scientific discovery needs to be implemented as quickly as possible for humanitarian reasons. CON: As with every new scientific technology, harmful side effects of genetic engineering are inevitable and great care should be taken in its implementation, including carefully controlled long-term tests on human health and environmental impacts. Natural Or Unnatural? PRO: Genetic engineering is a natural extension of traditional breeding; just as conventional breeding allows us to combine valuable traits within closely related species, genetic engineering allows scientists to access genes from a broader range of organisms to produce more valuable and productive crops and livestock. CON: Genetic engineering uses artificial laboratory techniques, rather than natural reproductive mechanisms, techniques which breach natural reproductive barriers and combine genes from distant species in ways that could never occur in nature -- suddenly altering genetic patterns that have developed over millions of years, and greatly increasing the likelihood of unanticipated side effects. Is The Process Precise? PRO: While natural breeding is an imprecise and uncontrolled combination of thousands of genes, genetic engineering is a precise technological process that allows scientists to first select the specific gene desired and then use "gene guns" and other techniques to insert that gene in the target organism precisely. CON: The choice of which gene to insert is indeed precise. But the insertion of this gene into a living cell is highly imprecise, with no control over where in the DNA the new gene is inserted. This unnatural process can disrupt the natural genetic information encoded in the DNA, as well as the regulation of gene expression, in ways that are uncontrolled and unpredictable. Have Tests Been Conducted? PRO: All genetically engineered foods have been thoroughly tested and demonstrated to be safe before they are released into the marketplace. CON: This testing is typically conducted only on rats and other animals, by the companies involved. Very little of this research has been reviewed by independent scientists and then published in scientific journals, and the FDA does not review the research methodology. Such a process is considered only preliminary with, for example, food additives and pharmaceutical drugs. Is Human Testing Needed? PRO: Genetically engineered foods are usually "substantially equivalent" to other foods, with no increased risk to human health, and no need for the lengthy and expensive human testing demanded of, for example, new food additives. CON: The unpredictable disruptions in normal DNA functioning caused by genetic engineering can produce unanticipated and unknown side effects for human health, including unknown and unpredictable toxins and allergens, and these possibilities can only be definitively assessed through human testing. Is Safety Demonstrated? PRO: Genetically engineered foods have been sold in the United States for several years and there is no evidence to indicate that these foods have harmed human health in any way. CON: There is also no evidence that genetically engineered foods are safe for human health. The reason is the same in both cases: no human studies have been conducted. There is no objective way to determine if any of these foods have long-term effects that negatively impact human health. Can We Eat Pesticide Foods Safely? PRO: Certain genetically engineered potatoes and corn produce their own Bt, a pesticide that protects the crop from insects, thus decreasing costs and increasing yield with no negative impact on human health. CON: These foods are regulated as pesticides by the EPA. When Bt is sold as a pesticide, people are warned not to swallow it, breathe it, or get it in cuts. Yet potatoes and corn that produce their own Bt are sold with no human testing. The Future Of Organics PRO: If people do not wish to eat genetically engineered foods then they have an option now; they can eat organic foods which, according to rules released by the United States Department of Agriculture, must be free of all genetic engineering. CON: Genetic engineering itself damages organic farming; genetically engineered corn, for example, outcrosses with organic corn in nearby fields and contaminates the crop; genetically engineered corn and potatoes containing the Bt toxin will produce insects resistant to Bt, making Bt spray ineffective for organic farmers. Environmental Impacts PRO: The use of genetic engineering in agriculture will increase crop productivity, thereby reducing the demand for agricultural land, while it will also reduce the use of herbicides and pesticides, thereby reducing the damage done to the environment through modern agrichemical farming technologies. CON: Several studies have been done, and there is little evidence to show that genetic engineering increases crop yield or reduces herbicide and pesticide use. Meanwhile, research has shown that genes for resistance to herbicides will outcross into the natural ecosystem, generating "super weeds," and that plants engineered to be pesticides will create resistant insect pests -- self-defeating processes that will irreversibly damage the environment. Moreover, no genetically modified food has yet been subject to an environmental impact study. Science vs. Culture PRO: Genetic engineering is a scientific and technological process, and its evaluation and governmental regulation should be based on purely scientific and objective criteria. CON: To have a purely scientific evaluation of genetically engineered foods, we need more science, especially human studies and environmental studies. Moreover, purely scientific assessment of genetic engineering ignores the fact that, for many people, food has cultural, ethical and religious dimensions that must also be considered. Patenting DNA PRO: Genetic engineering produces specific and identifiable changes in the genome of living organisms which can be protected through patent, and this protection of intellectual property within the DNA (the "software" of living organisms) is fueling the rapid development of new and better food sources. CON: Historically, farmers have created the world's crop varieties through natural breeding. To allow large corporations to use small genetic changes to take control of these collectively produced resources, as well as the evolutionary process itself, is to risk that these corporations will take control of agricultural output worldwide. Indeed, if a few large biotech businesses in Western nations have control of the seed used around the world, serious questions will arise about the independence and national sovereignty of all other nations. Equivalence Or Choice? PRO: Since genetically engineered foods released into the marketplace are "substantially equivalent" to conventional foods, with no significant difference in taste, usability or commonly measured nutritional components, they need not be labeled. CON: For a variety of reasons, including concerns about health testing, the environment, and religious and ethical values, genetically engineered food should be labeled as such, giving consumers a choice as to whether they wish to eat these foods and support their underlying values. Should There Be Labels? PRO: Most people can't tell the difference between conventional and genetically engineered foods, and given a choice, they will buy what is least expensive. CON: In nearly every country where polls have been taken, large majorities say they want genetically engineered foods to be labeled, so informed choices can be made. • PROS AND CONS OF CLONING • Opinions vary widely about farm animal cloning. The Dallas Morning News asked backers and opponents to list their arguments. Each side had a chance to comment on the other's arguments. • Pros • • Cloning allows breeders to create a genetic copy of "best in the barnyard" animals, with traits such as resistance to disease or higher milk yields. (Opponents: Cloning reduces genetic diversity needed to give a herd resistance to disease.) • • Cloning expands breeders' reproductive options. (Opponents: Other techniques accomplish the same results and are not as problematic.) • • Cloning reduces the impact of the injury or unexpected death of a prized animal. (Opponents: Freezing eggs, semen and embryos also accomplishes this.) • • Cloning improves the quality and consistency of a herd. (Opponents: This can be accomplished without cloning.) • Cons • • "Host mothers" suffer because of unusually high rates of spontaneous abortions. (Proponents: The percentage of pregnancies carried to term approaches that of other assisted breeding techniques.) • • Defects in clones, including oversized calves with respiratory and cardiac problems, are common. (Proponents: These problems occur more frequently in all forms of assisted reproduction.) • • No long-term studies have been done on the safety of food from clones. (Proponents: Meat and milk from clones has been studied more than the food we eat every day). • • There are moral and ethical concerns about animal cloning. (Proponents: Livestock cloning does not violate standards of kosher or halal foods and is approved by the Catholic Church.)
WHAT IS CLONING? The creation of one or more genetically identical animals by transferring the nucleus of a body cell into an egg from which the nucleus has been removed. This is also known as Nuclear Transfer (NT) or cell nuclear replacement (CNR) and is how Dolly was produced.
When scientists clone an animal, they take the nucleus of a cell -- which contains chromosomes made of deoxyribonucleic acid (DNA) and proteins -- and place it into an egg cell (also called an oocyte) from which the nucleus has been removed. The egg cell then divides to produce an embryo that develops into an animal - if the procedures work as planned.
HOW LONG HAVE THEY BEEN ABLE TO USE DNA TO HELP WITH CRIME SCENES?
Beginning with a single molecule of the genetic material DNA, the PCR can generate 100 billion similar molecules in an afternoon. The reaction is easy to execute. It requires no more than a test tube, a few simple reagents and a source of heat. The DNA sample that one wishes to copy can be pure, or it can be a minute part of an extremely complex mixture of biological materials. The DNA may come from a hospital tissue specimen, from a single human hair, from a drop of dried blood at the scene of a crime, from the tissues of a mummified brain or from a 40,000-year-old wooly mammoth frozen in a glacier." KARY MULLIS
Interactive websites DNA PROFILING INTERACTIVE GAME amnh.org/ology/genetics/dnadetective/pages/DNA_play.html nobelprize.org/educational_games/chemistry/pcr/
WHAT IS DNA PROFILING? 1. Each of us has a unique DNA profile or fingerprint. A technique called electrophoresis is used to obtain DNA profiles, relying on sections of our DNA . 2. Within our DNA there are areas called short tandem repeats (STRs) like one of the following base sequences:TGACCGATCATGCATGCATGCATGTTCCATGATAGCT This sequence starts off looking random and then has repeats of the sequence CATG towards the middle and then becomes random again. The repetitive section of the sequence is what is referred to as an STR. 3. For a given STR, you will have inherited different numbers of the repeated sequence from each of your parents. For example, you may have inherited 11 repeats of the CATG sequence, as shown above, on a chromosome from your mother, and 3 repeats of this sequence within the STR on the matching chromosome from your father.
WHAT IS DNA PROFILING? 4. Because the number of repeats within an STR will create different lengths of DNA for that STR, electrophoresis can be used to show how many repeats you have. 5. Generating a DNA profile usually involves analysing an individual's DNA for ten different STRs on different chromosomes. Statistically, no two people (except identical twins) are likely to have the same numbers of repeats in all of these STRs. 6. Polymerase chain reaction (PCR) is used first to produce many copies of the ten STRs before they are analysed using electrophoresis. The different lengths will show up as bands at different spots on the electrophoresis gel. The banding pattern produced is called a DNA profile or fingerprint, and can be analysed.
WHAT IS PCR? polymerase chain reaction (PCR) The process whereby a segment of DNA is copied or cloned, using DNA polymerase so that its sequence is multiplied many times in a laboratory. • WHAT IS ELECTROPHORESIS? • The process whereby an electric charge is used to separate molecules in a solution or gel according to electrical charge and size. It is routinely used to separate fragments of DNA.
GENETICS QUIZ • Genetics is the study of _________ or the passing of _________ from __________. • Rr is the _____________ and Pink and White is the _____________. • Rr would be described as _____________. • How many recessive allele’s must be present for the trait to be expressed? • How many traits are being crossed in a monohybrid cross? • How many traits are being crossed in a dihybrid cross? • Write out the column headings for a dihybrid cross between a heterozygous red flower Cc and a homozygous green flower cc.
GENETICS QUIZ 8. Co-dominance is a condition where ______ ________ for a trait are expressed. 9. Incomplete dominance is a condition where a ______________ is expressed. 10. In sex-linked traits, the allele is attached to the _______________. 11. If the offspring are XcX, XcY, XX, XY, circle the individual that would express the colorblind trait. 12. Cloning is the creation of _________ by ______________. 13. In Genetic Profiling, what is an STR? 14. What is the flow of information for Genetic Profiling?
GENETICS QUIZ 15. How many STR’s are in the following sequence? TGACCGATCATGCATGCATGCATGCATGAAGCGG? 16. What is PCR? 17. Where in the process of DNA profiling does PCR take place? 18.What is Electrophoresis? 19. Where in the process of DNA profiling does Electrophoresis take place? 20. What are some examples of physical evidence collected at a crime scene?