thad
Uploaded by
93 SLIDES
1257 VUES
960LIKES

Your Home Directory

DESCRIPTION

Your Home Directory. When you login to the server, you always start in your Home directory. Create sub-directories to store specific projects or groups of information, just as you would place folders in a filing cabinet.

1 / 93

Download Presentation
Télécharger la présentation

Your Home Directory

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Your Home Directory • When you login to the server, you always start in your Home directory. • Create sub-directories to store specific projects or groups of information, just as you would place folders in a filing cabinet. • Do not accumulate thousands of files with cryptic names in your Home directory

  2. File & Directory Commands • This is a minimal list of Linux commands that you must know for file management: • All of these commands can be modified with many options. Learn to use Linux ‘man’ pages for more information.

  3. Navigation • pwd (present working directory) shows the name and location of the directory where you are currently working:> pwd /home/jtang • This is a “pathname,” the slashes indicate sub-directories • The initial slash is the “root” of the whole filesytem • ls (list) gives you a list of the files in the current directory: • > ls assembin4.fasta Misc test2.txt bin temp testfile • Use the ls -l (long) option to get more information about each file > ls -l total 1768 drwxr-x--- 2 browns02 users 8192 Aug 28 18:26 Opioid -rw-r----- 1 browns02 users 6205 May 30 2000 af124329.gb_in2 -rw-r----- 1 browns02 users 131944 May 31 2000 af151074.fasta

  4. Sub-directories • cd (change directory) moves you to another directory >cd Misc > pwd /u/browns02/Misc • mkdir (make directory) creates a new sub-directory inside of the current directory > ls assembler phrap space > mkdir subdir > ls assembler phrap space subdir • rmdir (remove directory) deletes a sub-directory, but the sub-directory must be empty > rmdir subdir > ls assembler phrap space

  5. Shortcuts • There are some important shortcuts in Linux for specifying directories • . (dot) means "the current directory" • .. means "the parent directory" - the directory one level above the current directory, so cd .. will move you up one level • ~ (tilde) means your Home directory, so cd ~ will move you back to your Home. • Just typing a plain cd will also bring you back to your home directory

  6. Create new files • pico • nano • vi/vim • emacs

  7. Linux File Protections • File protection (also known as permissions) enables the user to set up a file so that only specific people can read (r), write/delete (w), and execute (x) it. • Write and delete privilege are the same on a Linux system since write privilege allows someone to overwrite a file with a different one.

  8. File Owners and Groups • Linux file permissions are defined according to ownership. The person who creates a file is its owner. • You are the owner of files in your Home directory and all its sub-directories • In addition, there is a concept known as a Group. • Members of a group have privileges to see each other's files. • We create groups as the members of a single lab - the students, technicians, postdocs, visitors, etc. who work for a given PI.

  9. View File Permissions $ ls -l total 2 -rw-r--r-- 1 jtang None 56 Feb 29 11:21 data.txt -rwxr-xr-x 1 jtang None 33 Feb 29 11:21 test.pl • Use the ls -l command to see the permissions for all files in a directory: • The username of the owner is shown in the third column. (The owner of the files listed above is jtang) • The owner belongs to the group “None” • The access rights for these files is shown in the first column. This column consists of 10 characters known as the attributes of the file: r, w, x, and - rindicates read permission w indicates write (and delete) permission x indicates execute (run) permission - indicates no permission for that operation

  10. Change Protections • Only the owner of a file can change its protections • To change the protections on a file use the chmod (change mode) command. [Beware, this is a confusing command.] • Taken all together, it looks like this: > chmod 644 data.txt This will set the owner to have read, write; add the permission for the group and the world to read 600, 755, 700,

  11. Commands for Files • Files are used to store information, for example, data or the results of some analysis. • You will mostly deal with text files • Files on the RCR Alpha are automatically backed up to tape every night. • cat dumps the entire contents of a file onto the screen. • For a long file this can be annoying, but it can also be helpful if you want to copy and paste (use the buffer of your telnet program)

  12. more • Use the command more to view at the contents of a file one screen at a time: > more t27054_cel.pep !!AA_SEQUENCE 1.0 P1;T27054 - hypothetical protein Y49E10.20 - Caenorhabditis elegans Length: 534 May 30, 2000 13:49 Type: P Check: 1278 .. 1 MLKKAPCLFG SAIILGLLLA AAGVLLLIGI PIDRIVNRQV IDQDFLGYTR 51 DENGTEVPNA MTKSWLKPLY AMQLNIWMFN VTNVDGILKR HEKPNLHEIG 101 PFVFDEVQEK VYHRFADNDT RVFYKNQKLY HFNKNASCPT CHLDMKVTIP t27054_cel.pep (87%) • Hit the spacebar to page down through the file • Ctrl-U moves back up a page • At the bottom of the screen, more shows how much of the file has been displayed • Similar command: less

  13. Copy & Move • cp lets you copy a file from any directory to any other directory, or create a copy of a file with a new name in one directory • cp filename.ext newfilename.ext • cp filename.ext subdir/newname.ext • cp /u/jdoe01/filename.ext ./subdir/newfilename.ext • mv allows you to move files to other directories, but it is also used to rename files. • Filename and directory syntax for mv is exactly the same as for the cp command. • mv filename.ext subdir/newfilename.ext • NOTE: When you use mv to move a file into another directory, the current file is deleted.

  14. Delete • Use the command rm (remove)to delete files • There is no way to undo this command!!! • We have set the server to ask if you really want to remove each file before it is deleted. • You must answer “Y” or else the file is not deleted. • But can use –f • rm –rf

  15. Some More Advanced Linux Commands • grep: searches a file for a specific text pattern • cut: copies one or more columns from a tab-delimited text file • wc: word count • | : the pipe — sends output of one command as input to the next • > : redirect output to a file • sed : stream editor – change text inside a file

  16. Perl

  17. Basic Concepts • Variables and Assignment • Conditions • Loop • Input/Output (I/O) • Procedures/functions

  18. Strings • Text is handled in Perl as a string • This basically means that you have to put quotes around any piece of text that is not an actual Perl instruction. • Perl has two kinds of quotes - single ‘ and double “ (they are different- single quote will print as is)

  19. Print • Perl uses the term “print” to create output • Without a printstatement, you won’t know what your program has done • You need to tell Perl to put a carriage return at the end of a printed line • Use the “\n” (newline) command • Include the quotes • The “\” character is called an escape - Perl uses it a lot

  20. #!/usr/bin/perl $DNA = 'ACGT'; # Next, we print the DNA onto the screen print $DNA, "\n"; print '$DNA\n'; print "$DNA\n"; exit;

  21. Do the Math (your 2nd Perl program) #!/usr/bin/perl print "4+5\n"; print 4+5 , "\n"; print "4+5=" , 4+5 , "\n"; [Note: use commas to separate multiple items in a print statement, whitespace is ignored]

  22. Variables • To be useful at all, a program needs to be able to store information from one line to the next • Perl stores information in variables • A variable name starts with the “$” symbol, and it can store strings or numbers • Variables are case sensitive • Give them sensible names • Use the “=”sign to assign values to variables $one_hundred = 100; $my_sequence = "ttattagcc";

  23. Array • @DNA = (1, 2, 3); • shift, unshift • push, pop • Index using []

  24. Hash • %TABLE=(A=>’CGT’, B=>’CCC’,);

  25. Hash • Initialize: my %hash = (); • Add key/value pair: $hash{$key} = $value; • Add more keys: • %hash = ( 'key1', 'value1', 'key2', 'value2 ); • %hash = ( key1 => 'value1', key2 => 'value2', ); • Delete: delete $hash{$key};

  26. String Operations • Strings (text) in variables can be used for some math-like operations • Concatenate (join) use the dot . operator $seq1= "ACTG"; $seq2= "GGCTA"; $seq3= $seq1 . $seq2; print $seq3; ACTGGGCTA

  27. #!/usr/bin/perl -w $DNA1 = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; $DNA2 = 'ATAGTGCCGTGAGAGTGATGTAGTA'; $DNA3 = "$DNA1$DNA2"; $DNA4 = $DNA1 . $DNA2; exit;

  28. #!/usr/bin/perl –w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print "Here is the starting DNA:\n\n"; print "$DNA\n\n"; # Transcribe the DNA to RNA by substituting all T's with U's. $RNA = $DNA; $RNA =~ s/T/U/g; # Print the RNA onto the screen print "Here is the result of transcribing the DNA to RNA:\n\n"; print "$RNA\n"; # Exit the program. exit;

  29. #!/usr/bin/perl -w # The filename of the file containing the protein sequence data $proteinfilename = 'NM_021964fragment.pep'; # First we have to "open" the file open(PROTEINFILE, $proteinfilename); $protein = <PROTEINFILE>; # Now that we've got our data, we can close the file. close PROTEINFILE; # Print the protein onto the screen print "Here is the protein:\n\n"; print $protein; exit;

  30. #!/usr/bin/perl -w # The filename of the file containing the protein sequence data $proteinfilename = 'NM_021964fragment.pep'; # First we have to "open" the file open(PROTEINFILE, $proteinfilename); # Read the protein sequence data from the file, and store it # into the array variable @protein @protein = <PROTEINFILE>; # Print the protein onto the screen print @protein; # Close the file. close PROTEINFILE; exit;

  31. #!/usr/bin/perl -w # array indexing @bases = ('A', 'C', 'G', 'T'); print "@bases\n"; print $bases[0], "\n"; print $bases[1], "\n"; print $bases[2], "\n"; print $bases[3], "\n"; exit;

  32. String functions • Chomp • Length of a string • Substring

  33. #!/usr/bin/perl -w $proteinfilename = 'NM_021964fragment.pep'; open(PROTEINFILE, $proteinfilename); $protein = <PROTEINFILE>; close PROTEINFILE; chomp $protein; $len = length $protein; print $len, ""; exit;

  34. #!/usr/bin/perl -w $name = "PALLAPP"; $st1 = substr($name, 3); $st2 = substr($name, 1, 2);

  35. Comparison • String comparison (are they the same, > or <) • eq (equal ) • ne(not equal ) • ge(greater or equal ) • gt (greater than ) • lt(less than ) • le(less or equal )

  36. #!/usr/bin/perl –w $word = 'MNIDDKL'; if($word eq 'QSTVSGE') { print "QSTVSGE\n"; } elsif($word eq 'MRQQDMISHDEL') { print "MRQQDMISHDEL\n"; } elsif ( $word eq 'MNIDDKL' ) { print "MNIDDKL-the magic word!\n"; } else { print "Is \”$word\“ a peptide?\n"; } exit;

  37. $x = 10; $y = -20; if ($x <= 10) { print "1st true\n";} if ($x > 10) {print "2nd true\n";} if ($x <= 10 || $y > -21) {print "3rd true\n";} if ($x > 5 && $y < 0) {print "4th true\n";} if (($x > 5 && $y < 0) || $y > 5) {print "5th true\n";}

  38. But • Use ==, <, <=, >, >=, !=, ||, && for numeric numbers • Use eq, lt, le, gt, ge, ne, or, and for string comparisons

  39. $x = 10; $y = -20; if ($x le 10) { print "1st true\n";} if ($x gt 5) {print "2nd true\n";} if ($x le 10 || $y gt -21) {print "3rd true\n";} if ($x gt 5 && $y lt 0) {print "4th true\n";} if (($x gt 5 && $y lt 0) || $y gt 5) {print "5th true\n";}

  40. #!/usr/bin/perl -w $num = 1234; $str = '1234'; print $num, " ", $str, "\n"; $num_or_str = $num + $str; print $num_or_str, "\n"; $num_or_str = $num . $str; print $num_or_str, "\n"; exit;

  41. More Arithmatics • +, -, *, **, /, % • +=, -=, *=, **=, /=, %= • ++, --

  42. $x = 10; $x = $x*1.5; print $x*=3, "\n"; print $x++, "\n"; print $x, "\n"; print ++$x, "\n"; print $x, "\n"; print $x % 3, "\n"; print $x**2, "\n";

  43. #!/usr/bin/perl -w print "Please type the filename of the DNA sequence data: "; $dna_filename = <STDIN>; chomp $dna_filename; open(DNAFILE, $dna_filename); $name = <DNAFILE>; @DNA = <DNAFILE>; close DNAFILE; $DNA = join('', @DNA); $DNA =~ s/\s//g; $count_of_CG = 0; $position = 0; while ( $position < length $DNA) { $base = substr($DNA, $position, 1); if ( $base eq 'C' or $base eq 'G') { ++$count_of_CG; } $position++; } print "CG content is ", $count_of_CG/(length $DNA)*100, "%\n";

  44. #!/usr/bin/perl –w print "Please type the filename of the DNA sequence data: "; $dna_filename = <STDIN>; chomp $dna_filename; open(DNAFILE, $dna_filename); $name = <DNAFILE>; @DNA = <DNAFILE>; close DNAFILE; $DNA = join('', @DNA); $DNA =~ s/\s//g; $count_of_CG = 0; for ( $position = 0 ; $position < length $DNA ; ++$position ) { $base = substr($DNA, $position, 1); if ( $base eq 'C' or $base eq 'G') { ++$count_of_CG; } } print "CG content is ", $count_of_CG/(length $DNA)*100, "%\n";

  45. $DNA = "ACCTAAACCCGGGAGAATTCCCACCAATTCTACGTAAC"; $s = ""; for ($i = 0, $j = 5; $i < $j; $i+=2, $j++) { $s .= substr($DNA, $i, $j); } print $s, "\n";

  46. sub extract_sequence_from_fasta_data { my(@fasta_file_data) = @_; my $sequence = ''; foreach my $line (@fasta_file_data) { if ($line =~ /^\s*$/) { next; } elsif($line =~ /^\s*#/) { next; } elsif($line =~ /^>/) { next; } else { $sequence .= $line; } } # remove non-sequence data (in this case, whitespace) from $sequence string $sequence =~ s/\s//g; return $sequence; }

  47. Subroutine • Some code needs to be reused • A good way to organize code • Called “function” in some languages • Name • Return • Parameters (@_)

  48. #!/usr/bin/perl –w print "Please type the filename: "; $dna_filename = <STDIN>; chomp $dna_filename; open(DNAFILE, $dna_filename); $name = <DNAFILE>; @DNA = <DNAFILE>; close DNAFILE; $DNA = join('', @DNA); $DNA =~ s/\s//g; $count_of_G = countG($DNA); print $count_of_G; sub countG { my($dna) = @_; my($count) = 0; $count = ( $dna =~ tr/Gg//); return $count; }

  49. #!/usr/bin/perl –w print "Please type the filename: "; $dna_filename = <STDIN>; chomp $dna_filename; open(DNAFILE, $dna_filename); $name = <DNAFILE>; @DNA = <DNAFILE>; close DNAFILE; $DNA = join('', @DNA); $DNA =~ s/\s//g; $count_of_G = count($DNA, 'Gg'); print $count_of_G; sub count { my($dna, $pattern) = @_; my($count) = 0; $count = ( eval("$dna =~ tr/$pattern//") ); return $count; }

  50. Scope • my provides lexical scoping; a variable declared with my is visible only within the block in which it is declared. • Blocks of code are hunks within curly braces {}; files are blocks. • Use use vars qw([list of var names]) or our ([var_names]) to create package globals.

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer