Genetics
Genetics. Chromosomes. Centromere. ↓. Chromatid. Chromatid. Karyotype – spread of human chromosomes to look for chromosomal abnormalities. OR. Chromosome Terminology.
Genetics
E N D
Presentation Transcript
Chromosomes Centromere ↓ Chromatid Chromatid
Karyotype – spread of human chromosomes to look for chromosomal abnormalities OR
Chromosome Terminology • Homologous Chromosomes – paired chromosomes – same size, same banding pattern, same type of genes but not necessarily the exact same forms of each gene • Example – gene on one chromosome for brown eyes and gene on its homologue for blue eyes GGGTCAGTCATTTTAAGAGATC GGGAAAGTCATTTTAAGAGATC • Remember – Sister Chromatids are two halves of the same double chromosome and are exact copies of one another
Cell Types • Diploid – cell with the normal # of chromosomes (2n) • Haploid – cell with ½ the normal number of chromosomes (n) • Somatic cell – normal body cell • Sex Cell, gamete – sperm and egg – haploid cells • Germ cell – 2n cell that is the precursor to the gametes • Meiosis – cell division process that produces the sperm and egg (n)
Purpose of Meiosis • To make haploid sex cells so that when they come together, the zygote has the normal amount of DNA (2n) Sperm n Egg n Fertilization → Mitosis Zygote 2n Embryo
Steps of Meiosis Germ Cell (2n) in G1 (46 single chromosomes) S-Phase – copy all DNA so after have 46 double chromosomes When Chromosomes form in meiosis I – 46 doubles Chromosomes form and homologous pairs come together
Homologous Pairs line up down center Still 46 doubles or 23 double pairs Each daughter cell has 23 double chromosomes – no longer have pairs – just one of each pair
Meiosis I is the reduction division because the cell went from 46 chromosomes or 23 pairs to just 23 chromosomes The daughter cells are now haploid but they don’t yet have ½ of the DNA of the orginial germ cell, they must undergo meiosis II
Chromosomes reform in the two daughter cells Each individual chromosome lines up down the center and sister chromatids split
Now that sister chromatids split – we have 23 single chromosomes – ½ the DNA of a normal cell – this is the finished sex cell
Summary • Meiosis happens only in ovaries and testes to make sperm and egg • Sperm and egg have only 1 of each pair of chromosomes and are haploid • Sex cells come together to make a zygote that contains a pair of each chromosomes again and is diploid
Germ cell = spermatogonium (undergo mitosis and one daughter cell goes thru meiosis) Primary Spermatocyte – Prophase I ↓ meiosis I Secondary Spermatocyte – haploid ↓ meiosis II Spermatids Sperm (grow tails and head changes shape) Germ cell = oogonium (undergo mitosis and one daughter cell goes thru meiosis) Primary oocyte (Prophase I) (frozen in metaphase I) ↓ meiosis I (hormone stim.) Secondary oocyte (haploid) and 1 polar body (frozen in met II) ↓ meiosis II (stimulated by fert.) Oocyte + 2nd polar body Egg vs. Sperm
Sexual Reproduction Brings about Variation by: • Crossing Over • Independent Assortment • Amount of variation due to IA – 2n • In humans = 2 23 = 8 million • Random Fertilization • 8 million x 8 million = 64 trillion combinations • Crossing Over makes this almost infinite
Chromosomal Abnormalities • Trisomy or Monosomy due to non-disjunction during meiosis • Chromosomal deletions (a piece of a chromosome breaks off) • Chromosomal Translocations (whole or parts of chromosomes) • Chromosomal Inversions
Non-disjunction causes trisomy’s, monosomy’s, and aneuploidy
Chromosomal Abnormalities Translocation of chromosome 13 and 14 – normal phenotype
Translocation Abnormality Philadelphia Chromosome A piece of chromosome 22 is translocated to chromosome 9 causing Chronic Myelogenous Leukemia
Chromosomal Deletions Each chromosome 22 on the right of each pair is missing a piece Cri-du-chat – have a deletion from chromosome #5 and the babies sound like a cat crying – mental retardation and heart disease
Mendelian Principles • Alleles – different forms of the same gene • Dominant – gene that is seen • Recessive – only seen if with another recessive allele • Homozygous – having 2 like alleles • Heterozygous – having 2 different alleles • Genotypes – actual gene make-up for a particular locus or trait • Phenotypes – visible trait
Mendelian Laws • Law of Segregation - When the gametes form – each gamete receives only 1 of each pair of alleles. • Law of Independent Assortment – If genes aren’t on the same chromosome (linked) they will not have to remain together in the gamete - if they are linked, they will sometimes assort independently due to crossing over
Punett Squares – Mono and Di-Hybrid Crosses Used to calculate the probability of having certain traits in offspring • Figure out all possible gametes for male and females • Place them on the outside of the square • Cross the gametes to come up with the possible genotypes and phenotypes of the offspring
Using Probability to Calculate Offspring Outcomes Rather than Punnett Squares Multiply – when 2 things must happen independently in order to get the outcome (and) Add – when either of two things can happen to get an outcome. (or) Examples: RrYy x RrYy Chance of getting an rryy offspring? Chance of getting an RrYr offspring?
Beyond Mendel • Incomplete Dominance – the phenotype in the heterozygous condition is a mix of the two (white and red snapdragons make pink) • Co-dominance – both alleles are expressed in heterozygous condition (A,B blood types, Roan cattle) • This can become a “gray” area in diseases – Tay Sachs – make ½ normal protein and ½ misshapen – do not exhibit disease so recessive but molecularly have both expressed so is it co-dominance or even incomplete if has a slight effect ????
Multiple Alleles • More than two allele choices although always only have 2 alleles at each gene locus • Example: Human Blood TypesAlleles = A, B, & O (also an example of co-dominance) • Paternity Testing?
Sex-Linked • Located on a sex chromosome • Usually is X-linked (few known genes on the Y) • X-linked usually show more in males since only have 1 allele – only need 1 recessive allele to show
Pedigrees • Used to figure out genotypes of family members to see if someone is carrying a disease gene • Used to determine the mode of inheritance • Practice
Genetics Plays a Role in History Queen Victoria’s daughter, Alice, married a German prince, Louis, and converted to Lutheranism. Their daughter, Queen Victoria’s granddaughter, Alexandra was, thus, a German princess, grew up in Germany, and was raised in the Lutheran church. Alexandra, married Tsar Nicholas, the last tsar of Russia, and they had four daughters: Olga, Tatiana, Marie, and Anastasia. Many people in Russia didn’t like Tsarina Alexandra because she was German, not Russian, and Lutheran, not Russian Orthodox. Her mannerisms, speech, and dress were not what many people in Russia thought of as appropriate for the Tsar’s wife. Also, in Russia at that time, only a male could be tsar, so unless Alexandra and Nicholas had a son, the leadership would pass to another of Nicholas’ relatives when he died. Finally, however, they had a son who they named Alexei. Unfortunately, however, they soon discovered that he had inherited the hemophilia allele from Alexandra, from Alice, and from Queen Victoria. Realizing that chances were very slim that Alexei would survive to adulthood, Tsar Nicholas and his family became very withdrawn to try to keep that a secret (Alexandra was not very outgoing, anyway, which the people didn’t like). However, at that time, there was much social unrest in Russia, and the general public mistook the royal family’s withdrawl for aloofness and as a sign that they didn’t care about the poor living conditions of their people. Thus, Alexei’s hemophilia was probably a major contributing factor in the Russian revolution. On several occasions, Alexei had severe internal bleeding, and a rather disreputable man named Rasputin was somehow able to stop the bleeding. Because of his inexplicable ability to help Alexei, Rasputin became part of the “inner circle” and close confidant of the royal family, which also angered many people who did not trust him. Thus, when the Russian Revolution began, Rasputin was among the first to be executed. Eventually, Tsar Nicholas and his family were put under house arrest in Siberia. On 18 June 1918, Anastasia, the youngest of the daughters, turned 17 while the family was still under house arrest, and about a month later, just after midnight on 16 July, the royal family and several of their servants were all ordered down into the basement of the house, and the soldiers who had been guarding them shot and killed them all. Then, their remains were taken out of town, burned in a bonfire, then buried, together, in an unmarked grave. For years, no one knew where that grave was until, when Communist rule ended, records became available. In 1991, what was thought to, perhaps, be that grave was found, the bones were carefully removed, and as much as possible, the skeletons were reconstructed. Through the use of modern DNA technology, DNA samples from the bones were compared to DNA from the Tsar’s brother’s body (buried in a crypt in a church in St. Petersburg) and to DNA from someone in the English royal family. On that basis, one adult male skeleton was identified as the Tsar, several young adult female skeletons were identified as several of the daughters, and the DNA of several of the other skeletons didn’t match, showing that they were unrelated, family servants. The skeletons of Alexei and one of the four daughters were not with the rest, and are still unaccounted for. After the bones were studied and identified, a few years ago, the remains of the last Tsar of Russia and his family were given a proper funeral and burial. In 1919, a young woman jumped off a bridge in Berlin, Germany and was rescued and hospitalized. While in the hospital, on one occasion she showed a magazine article with a photo of the Russian royal family to a nurse, pointing out to the nurse how much she thought she looked like Anastasia. After that, she claimed to be Anastasia and claimed to have escaped and survived. She later moved to the U. S. and went by the name of Anna Anderson. The rest of her life, she stuck to her story that she was Anastasia, but people were dubious and tried everything they could think of (including things like comparing pictures of ear lobes) to figure out whether she was Anastasia, or not. When she died and was cremated in 1984, no one still knew if she was really Anastasia or not. At some point before her death, she had had surgery, and the hospital had kept the removed tissue preserved in formaldehyde. Again in the 1990s, with the advent of modern DNA technology, scientists were also able to test DNA samples from her preserved tissue and compare those to the other DNA samples, with the result that there were no similarities – she was not related. Another possible use for DNA technology has been suggested. The big question in all of this is, “From where did Victoria get the hemophilia allele?” Neither her mother, Victoria, nor her father, King Edward showed any signs of having that allele. The “standard” explanation which, for many years, has been offered to freshman biology students is that there was a chance, random mutation in that allele on one of Queen Victoria’s X chromosomes. More recently, however, I have heard suggestions that, at that time, if the royal couple was having trouble conceiving a child, it would not have been out of the question to quietly, unobtrusively “loan” the Queen out. People have raised the suggestion that maybe King Edward is not Victoria’s biological father. It has been suggested that perhaps there was not a chance mutation in one of Queen Victoria’s X chromosomes, but that, perhaps, that was inherited from another man. Since the bodies of deceased members of the royal family are in crypts in Westminster Abbey, it would be fairly easy to lift the lids on a couple of crypts to get DNA samples for comparison, but needless to say, the British royal family probably isn’t very enthused about that idea.
Warm up First 3 correct answers = bonus • You are a genetic counselor and couple wanting to start a family comes to you for information • Charles was married once before, and he and his first wife had a child with cystic fibrosis. The brother of his current wife, Elaine, died of cystic fibrosis. • Neither Charles or Elaine have CF. What is the probability of Charles and Elaine having a baby with CF?
Higher Genetics • Pleiotropy – one gene effects many traits • Albinism – 1 mutation in 1 gene affects skin color, eye color, hair color, and eyesight • In mice – coat color affects how they react to light • Epistasis – one gene effects the expression of another • bb – brown coat color • Bb, BB – black coat color • C gene – dominant causes color to be deposited in coat so if no C gene then white coat color (in case of lab retrievers – yellow) • Polygenic – one trait determined by many genes – continuous pattern • Multifactorial – may be multiple genes and the environment
Linkage Mapping – determining where genes are on a chromosome relative to other genes • If 2 genes are on the same chromosome, they will remain together in the gamete – if they don’t stay together it is due to crossing over • The closer two genes are on the same chromosome - the more likely they will stay together and not separate due to crossing over • If you calculate % of the time crossing over occurs and separates the genes, you can tell relatively how far apart they are on the chromosome. (low % close, high % far) • Distance isn’t a real # - it’s just relative – called a map unit or Centimorgan.
Example of Linkage Mapping Blonde hair Brown Hair Blue Eyes Brown Eyes • If no crossing over – Blonde Hair and Blue Eyed genes will always end up in the gamete together or Brown Hair and Brown Eyes. • If crossing over occurs you can get Blonde Hair and Brown eyes in the same gamete etc. • However, the gamete from this parent will combine with another parent so how do you calculate the % of time crossing over happens?
Example: Brown Hair – H Blonde Hair – h Brown Eyes – E Blue Eyes – e HhEe x hhee All offspring will be: HhEe and hhee so will look like parents (blonde hair and blue eyes tog. And browns together) If crossing over: Hhee and hhEe Linkage Mapping continued • Take one parent that is heterozygous for both genes that you want to map and cross them with another parent that is homozygous recessive – any offspring that aren’t like either parent are due to crossing over • Take the # of offspring due to crossing over/# of total offspring = % crossing over = relative distance those gene are from each other Problem Practice; Offspring: HhEe – 400 hhee – 400 Hhee – 100 hhEe – 100 How many map units are the genes H and E apart?
Linkage Mapping Problem • Problem – if they are really far apart, it may be >50% and cannot be distinguished from being on separate chromosomes
Example of Calculating % Recombination and map units BbTt x bbtt If the genes are on separate chromosomes: BT Bt bT bt BbTt Bbtt bbTt bbtt X bt = If on the same chromosome: BbTt bbtt BT bt X bt = But got: 965 BbTt – 5 944 bbtt – 5 206 Bbtt – 1 (these 2 due to 185 bbTt – 1 crossing over) (just like parents) 391/2300 = 17% recomb. 17 map units
Practice Linkage Mapping • TA = 12 % recombination • AS = 5 % recombination • TS = 18 % recombination • Pick smallest distance and lay them out A ------ S Is T closer to A or S? T is closer to A so it goes to the left of A T ------- A ------ S -------------------- 5% 12% 5% 18%
Practice Problems - # 4, 5, 9 Chapter 15 4. A Wild type fruit fly (heterozygous for gray body and normal wings) is mated with a black fly with vestigial wings. Offspring: Wild type 778 Black vestigial 785 Black normal 158 Gray vestigial 162 What is the recombination frequency between these genes for body color and wing size? Answer: 320/1883 = 17% = 17 map units
A wild-type fly (heterozygous for gray body and red eyes) is mated with a black fruit fly with purple eyes. The offspring: 721 wt 751 black-purple 49 gray-purple 45 black-red What is the recombination frequency? What would you mate if you wanted to determin the sequence of body-color, wing-size, and eye color? Answer: 94/1566=6% Mate heterozygous wing size and eye color (gray,red) and homo rec for wing and eye (vest,purple)
Mapping Problem - #9 • Determine the sequence of genes along the chromosome based on the following recombination frequencies. • A-B = 8 map units • A-C = 28 • A-D = 25 • B-C = 20 • B-D = 33 Answer: start with smallest distance and work your way out: D ----25---- A --8-- B ---20---C
Chromosomal Inheritance • Aneuploidy – abnormal chromosome # (ex. Trisomy) • Polyploidy – 3n, 4n (non-disjunction of all chromosomes) • More normal than aneuploid – some plants live fine but can only reproduce with other polyploid plants • 2n egg and 1n sperm = 3n Or • Zygote replicates DNA but doesn’t divide = 4n