ting
Uploaded by
29 SLIDES
467 VUES
290LIKES

Chapter 25

DESCRIPTION

Chapter 25. Gene Expression and Protein Synthesis. eukaryotes (humans) In Nucleus of cell. Eukaryotes (humans) In cytoplasm Bacteria (transcriptn + translatn). Introduction. The central dogma of molecular biology

1 / 29

Download Presentation
Télécharger la présentation

Chapter 25

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Chapter 25 Gene Expression and Protein Synthesis

  2. eukaryotes (humans) In Nucleus of cell Eukaryotes (humans) In cytoplasm Bacteria (transcriptn + translatn) Introduction • The central dogma of molecular biology • Information contained in DNA molecules is expressed in the structure of proteins. • Gene expression is the turning on or activation of a gene.

  3. Transcription • -the process by which information encoded in a DNA molecule is copied into an mRNA molecule. • 1. Transcription starts when the DNA double helix begins to unwind near the gene to be transcribed. • 2. Only one strand of the DNA is transcribed. • 3. Ribonucleotides assemble along the unwound DNA strand in a complementary sequence. • Enzymes called polymerases(poly) catalyze transcription: • poly I: formation of  rRNA formation, • poly II: formation of  mRNA formation • poly III: formation of  tRNA formation. 1. 2. 3. 4.

  4. Transcription • A eukaryotic gene has two RNA; the parts: • A structural gene that is transcribed into structural gene is made of exons and introns. • A regulatory gene that controls transcription; the regulatory gene is not transcribed but has control elements, one of which is the promoter. 3. A promoter is unique to each gene. • There is always a sequence of bases on the DNA strand called an initiation signal. • Promoters also contain consensus sequences, such as the TATA box, in which the two nucleotides T and A are repeated many times. 2. 3. 1. 4. 5. Figure 25.2

  5. RNA in Translation • mRNA, rRNA, and tRNA all participate in translation. • Protein synthesis takes place on ribosomes (e.g. rRNA). • A ribosome dissociates into larger (60S) and a smaller body (40S). • The 5’ end of the mature mRNA is bonded to the 40S ribosome and this unit then joined to the 60S ribosome. • Triplets of bases on mRNA are called codons. e.g. AUG • The 20 amino acids are then brought to the mRNA-ribosome complex, each amino acid by its own particular tRNA (e.g. w/ Met). rRNA-40S mRNA rRNA-60S tRNA Note: anticodon for AUG: UAC  “Met” see table 25.1

  6. tRNA • Each tRNA is specific for only one amino acid (e.g. UAC  Met). • Cell carries at least 20 specific enzymes (e.g. AARS) each specific for one amino acid. • (i.e. links Amino acids with spec. tRNA) • NOTE: 20 amino acids always/usually present in cytoplasm to make proteins (usually) otherwise-bad hair day? Poor nutrition. . . Limited amino acid(s) in diet • Challenge Question? What is the only food with all 20 amino acids in one serving? • Most important segments of tRNA • 1. site where enzymes attach amino acids (3’ end) • 2. recognition site. (three basses anticodon: UAC bondS AUG) tRNA (e.g. Met) 1. Expanded tRNA mRNA (e.g. Met) (AARS) 2. anticodon UAC

  7. Confirming your Knowledge If a codon is CGU (mRNA) what is it’s anticodon? What amino acid does the code for? Hint see table 25.1 mRNA

  8. The Genetic Code • Assignments of triplets is based on several types of experiments. • One of these used synthetic mRNA. • If mRNA is polyU, polyPhe is formed; the triplet UUU, therefore, must code for Phe. • If mRNA is poly ---ACACAC---, poly(Thr-His) is formed; ACA must code for Thr, and CAC for His. • By 1967, the genetic code was broken.

  9. The Genetic Code: Table 25.1 NOTE:

  10. AUG CGUAGUAAUGGUAGUAUAUAA Stop codon Start codon Features of the Code • All 64 codons have been assigned. • 61 code for amino acids. (What about the others 3?) • 3 (UAA, UAG, and UGA) serve as termination signals. • AUG, universal start signal. • Only Trp and Met have one codon each. • More than one triplet can code for the same amino acid; Leu, Ser, and Arg, for example, are each coded for by six triplets.

  11. Confirming your Knowledge If you had 750 DNA segment, (assume Met (AUG) and stop codon UUG are stripped off ) How many Amino acids appear in the protein the DNA codes for? Features of the Code • For the 15 amino acids coded for by 2, 3, or 4 triplets, it is only the third letter of the codon that varies. Gly, for example, is coded for by GGA, GGG, GGC, and GGU. • The code is almost universal: it the same in viruses, prokaryotes, and eukaryotes; the only exceptions are some codons in mitochondria. • Supports Darwins theory of evolution

  12. Translation • the process whereby a base sequence of mRNA is used to create a protein. • There are four major stages in protein synthesis: • 1. Activation • 2. Initiation • 3. Elongation • 4. Termination

  13. Protein Synthesis • Activation 1. Hydrolize ATP AMP 2. Link adenosine to Amino acid 1. 2.

  14. Amino Acid Activation • 1. Activated amino acid is bound to spec. tRNA • 2. w/ ester carboxyl group of the amino acid and the 3’-OH of the tRNA. (e.g. Cys) 2. 1. (e.g. Cys) (AARS)

  15. P site A site E site Chain Initiation 40S 1. • Figure 25.4 Formation of an initiation complex. mRNA 1. 40S rRNA binds with mRNA 40S 2. tRNA binds with 40S rRNA/mRNA 3. 2. 3. 60S rRNA binds with 40S rRNA/mRNA 60S Acceptor (A) Site Protein (P) Site Exit (E) Site (tRNA) 60S

  16. Elongation: Figure 25.6 Show Videos 26.6 E site Process: Hydrolyzes GTP GDP A site P site Forms peptide bond (b/w Ala-Met)

  17. Peptide Bond Formation • Peptide bond formation in protein synthesis.

  18. Termination X-ray model of Ribosome w/ rRNA tRNA mRNA • Chain termination requires: • Termination codons (UAA, UAG, or UGA) of mRNA. • Releasing factors that cleave the polypeptide chain from the last tRNA and release the tRNA from the ribosome. Fig. 25-7, p. 629 UAA (terminate me (‘.’)

  19. Gene Regulation • the various methods used by organisms to control which genes will be expressed and when. • 1. Regulations operate at the transcriptional level (DNA  RNA) • 2. Others operate at the translational level (mRNA  protein). 1. Transcriptional Level In eukaryotes, transcription regulated by 3 elements: promoters, enhancers, and response elements.

  20. 2. Translational Level • a number of mechanisms that ensure quality control. • A. aminoacyl-tRNA synthase (AARS) control Each amino acid must bond to the proper tRNA. B. Termination control stop codons must be recognized by release factors. C. Post-translational control • In most proteins, the Met at the N-terminal end is removed by Met-aminopeptidase. • Certain proteins called chaperones help newly synthesized proteins to fold properly.

  21. Mutations and Mutagens • Mutation: a heritable change in the base sequence of DNA. • It is estimated that, on average, there is one copying error for every 1010 bases. • Mutations can occur during replication. • Base errors can also occur during transcription in protein synthesis (a nonheritable error). • Other errors in replication may lead to a change in protein structure and be very harmful.

  22. Mutations and Mutagens • Chemical(s) that causes a base change in DNA. • What are common mutagens we are all exposed to? • Cells have repair mechanisms callednucleotide excision repair (NER) units  prevents mutations. • NER can prevent mutations by cutting out damaged areas and resynthesizing them. • Not all mutations are harmful. • Certain ones may be beneficial because they enhance the survival rate of the species.

  23. Restriction enzyme cleaves here . . . Recombinant DNA • DNA from two sources that have been combined into one molecule. • One example of the technique begins with plasmids found in the cells of Escherichia coli. • plasmid: a small, circular, double-stranded DNA molecule of bacterial origin. • A class of enzymes called restriction endonucleases cleave DNA at specific locations. • One, for example, may be specific for cleavage of the bond between A-G in the sequence -CTTAAAG-.

  24. Sticky ends Recombinant DNA • In this example “B ” stands for bacterial gene, and “H for human gene. • The DNA is now double-stranded with two “sticky ends”, each with free bases that can pair with a complementary section of DNA. • Next, we cut a human gene with the same restriction endonuclease; for example, the gene for human insulin.

  25. Recombinant DNA • The human gene is now spliced into the plasmid by the enzyme DNA ligase. • Splicing takes place at both ends of the human gene and the plasmid is once again circular. • The modified plasmid is then put back into the bacterial cell where it replicates naturally every time the cell divides. • These cells now manufacture the human protein, in our example human insulin, by transcription and translation.

  26. Recombinant DNA • Figure 25.11 The recombinant DNA technique. 1st human insulin produced by fermentation 1972 In 1972, University of California, San Francisco, biochemist Herbert Boyer met Stanford University geneticist Stanley Norman Cohen. Cohen founded Genentech 1976

  27. Cloning DNA • Figure 26.17 The cloning of human DNA fragments with a viral vector.

  28. Gene Therapy • Figure 26.18 Gene therapy via retroviruses.

  29. Protein Synthesis Gene Expression and Protein Synthesis End Chapter 26

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer