1 / 6

DNA

DNA. The Secrets it tells us about Evolution!. Remember:. Gene – Chromosome – 1 molecule of DNA = 1 chromosome What are the building blocks of DNA? What are the building blocks of protein?. How do genes code for genetic traits?. Answer: 1 gene  code for  one protein! Examples:

tod
Télécharger la présentation

DNA

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. DNA The Secrets it tells us about Evolution!

  2. Remember: • Gene – • Chromosome – • 1 molecule of DNA = 1 chromosome • What are the building blocks of DNA? • What are the building blocks of protein?

  3. How do genes code for genetic traits? • Answer: 1 gene  code for  one protein! • Examples: • Eye color • Hair color • Normal Blood clotting vs. hemophilia

  4. We know how the code works! • CCCGATATTACGCTTAGGTACCGTC • Every 3 bases code for one amino acid!(See board)

  5. DNA & Evolution • Chimpanzees and Humans share 98-99% of their DNA! • CCCGTCAGGCTAATACGAGCGGT • CCCGTCGGGCTAATACGAGCGGT

  6. DNA & Evolution • Who can read the human genetic code? • The genetic code is UNIVERSAL! • Practical Implication:Genetic engineering: Bacteria are programmed with HUMAN insulin gene to produce………….?

More Related