1.56k likes | 3.29k Vues
Primer Design. http://frodo.wi.mit.edu/. Put in your sequence. Primer size. Annealing temperature. % GC. Your sequence. Left primer. Right primer. Pick primers. Product size. Left primer. Right primer. Search for RE site. BioEdit. Cloning & Expression Vector. DEFINITIONS. Clone.
E N D
Primer Design http://frodo.wi.mit.edu/
Primer size Annealing temperature % GC
Your sequence Left primer Right primer Pick primers
Product size Left primer Right primer
Search for RE site BioEdit
DEFINITIONS Clone Cloning
Application • Cloning can be used to test for genetic diseases • Regenerate nerves or spinal cord tissue • Help in plastic surgery • Clone organs for transplantation • Grow skin grafts for burn victims • Manufacture bone, fat, and cartilage
What is cloning? • -
Drug Resistance Gene Transferred by Plasmid Drug Resistant Gene mRNA Plasmid Resistant Strain Plasmid gets out and into the host cell Enzyme Hydrolyzing Antibiotics New Resistance Strain Non-resistant Strain Juang RH (2004) BCbasics
Target Genes Carried by Plasmid Target Genes Restriction Enzyme Restriction Enzyme Chromosomal DNA DNA Recombination Target Gene Recombination Transformation 1 plasmid 1 cell Host Cells Recombinant Plasmid Transformation Juang RH (2004) BCbasics
Amplification and Screening of Target Gene 1 Plating 1 cell line, 1 colony Plasmid Duplication X100 Bacteria Duplication X1,000 Pick the colony containing target gene =100,000 Juang RH (2004) BCbasics
Design of the Insert • Once you have your restriction enzymes chosen, it is time to design the final complete gene • The multiple cloning site (or whatever plasmid you are cloning into) should already have the 5’ portion of the gene intact (i.e. RBS, spacer, Met) • Sequences must be in frame NcoI BtgI 51 CTTTAATAAG GAGATATACC ATGGGCAGCA GCCATCACCA TCATCACCAC M G S S H H H H H H SacI AscI SbfI SalI NotI BamHI EcoRI EcoICRI BssHII PstI AccI HindIII 101AGCCAGGATCCGAATTCGAG CTCGGCGCGC CTGCAGGTCG ACAAGCTTGC S Q D P N S S S A R L Q V D K L A
Design of the Insert Multiple cloning site 71 ATGGGCAGCAGCCATCACCATCATCACCAC M G S S H H H H H H SacI AscI SbfI SalI BamHI EcoRI EcoICRI PstI AccI HindIII 101AGCCAGGATCCGAATTCGAGCTCGGCGCGCCTGCAGGTCGACAAGCTTGC S Q D P N S S S A R L Q V D K L A The gene we want: ggctgcgacagggcgagcccgtactgcggttaa G C D R A S P Y C G * Be aware of the amber stop codon: TAG BamHIPstI AGCCAGGATCCGAATTCGAGCTCGGCGCGCCTGCAGGTCGACAAGCTTGC S Q D P N S S S A R L Q V D K L A G C D R A S P Y C G * ggctgcgacagggcgagcccgtactgcggttaa AGCCAGGATCCGggctgcgacagggcgagcccgtactgcggttaaCTGCAGGTCGACAA
Design of the Insert Always check and re-check your sequence! ATGGGCAGCA GCCATCACCA TCATCACCAC AGCCAGGATCCGggctgcgacagggcgagcccgtactgcggttaaCTGCAGGTCGACAA Translate the whole gene atgggcagcagccatcaccatcatcaccacagccaggatccgggctgcgacagggcgagc M G S S H H H H H H S Q D PG C D R A Sccgtactgcggttaactgcaggtcgacaa P Y C G -L Q V D Everything looks good: in frame the whole way!
Design of the Insert The wrong way to do it: AGCCAGGATCC ggctgcgacagggcgagcccgtactgcggttaaCTGCAGGTCGACAAGCTT The gene is just inserted after the restriction site, which is out of frame with the plasmid-encoded start-codon/His-tag atgggcagcagccatcaccatcatcaccacagccaggatccggctgcgacagggcgagcc M G S S H H H H H H S QD PA A T G R Acgtactgcggttaactgcaggtcgacaagctt R T A V N C R S T S Frame shifted = garbage! **Some plasmids, for whatever reason, have restriction sites out of frame with the translated gene**
Finishing Touches • Restriction enzymes need 5’ and 3’ base pairs to cut properly • NEB has a reference guide for specific enzymes (see link below) • A good rule of thumb is 6 base pairs after the recognition site • Inserting a GC “clamp” at the end and beginning of the sequence is also a good idea atgggcagcagccatcaccatcatcaccacagccaggatccgggctgcgacagggcgagc M G S S H H H H H H S Q D PG C D R A Sccgtactgcggttaactgcaggtcgacaa P Y C G -L Q V D Final gene, polished and ready to go: gccagccaggatccgggctgcgacagggcgagcccgtactgcggttaactgcaggtcgacgc S QD PG C D R A S P Y C G -L QV D http://www.neb.com/nebecomm/tech_reference/restriction_enzymes/cleavage_linearized_vector.asp
Design of the Primers Once the insert is designed correctly, the next step is designing primers to order from IDT, based on insert synthesis strategy • Three main strategies towards insert synthesis: • PCR amplification • Klenow extension of overlapping primers • Complimentary full-length primers + Insert Vector
PCR Amplification of Insert from an Existing Gene • The most common method of insert synthesis • Necessitates a pre-existing construct • Extra restriction sites and/or amino acid residues can be added on each side of the gene • Internal mutations are more difficult Insert
PCR Synthesis of Insert • PCR amplification from overlapping primers • No pre-existing construct is needed • PCR products messy, possibly making subsequent rxns difficult • Good for inserts >150 bp F1: 10x 5’ 3’ F2: 1x 5’ 3’ 5’ 3’ R1: 1x 3’ 5’ R2: 10x Insert Full-length insert should still be the major product
5’ 3’ 5’ 3’ Klenow Klenow Extension of Overlapping Primers • Two primers that are complimentary in their 3’ region are designed (overlap 15bp) • Extended to full length by the Klenow fragment of DNA Polymerase I • Useful if insert is 50 to 150 bp 5’ 3’ 5’ 3’ Insert Klenow fragment: retains 3’ to 5’ polymerase activity, but does not have exonuclease activity
Complimentary Full-Length Primers • The simplest approach • Order two primers that compliment each other • Mix the two primers, heat, and anneal slowly (to ensure proper base-pairing) • Feasible if the total insert size is < 60 bp Anneal 3’ 5’ Insert 3’ 5’
Designing Primers to Order Once the insert synthesis technique is decided, primer design is fairly straight-forward • Forward primers: • Assess necessary overlap and copy the sequence from your designed gene, along with extra 5’ sequence • Reverse primers: • First, design exactly as if it were a forward primer: Copy necessary overlap and extra 3’ sequence from your designed gene • Once all this is in place, use pDRAW32 sequence manipulator to calculate the reverse compliment • Order the pDRAW32 calculated sequence directly
Cloning Out an Existing Gene Forward Primer: Design of Reverse Primer: gccagccaggatccgggctgcgacagg ccgtactgcggttaactgcaggtcgacgc In the example mentioned previously, we would normally use full length overlapping primers, but let’s look at the more common case of having a preexisting gene: Preexisting gene: Overlap tgcggcccagccggccatgggctgcgacagggcgagcccgtactgcggtggaggcggtgctgcagcgc A A Q P A M G C D R A S P Y C G G G G A A A + Goal gene: gccagccaggatccgggctgcgacagggcgagcccgtactgcggttaactgcaggtcgacgc S QD PG C D R A S P Y C G -L QV D Extra sequence from gene design
Ordering Primers Now we can order the primers: http://www.idtdna.com/Home/Home.aspx gccagccaggatccgggctgcgacagggcgagcccgtactgcggttaactgcaggtcgacgc S Q D P G C D R A S P Y C G - L Q V D Forward primer to order: gccagccaggatccgggctgcgacagg Design of Reverse Primer: ccgtactgcggttaactgcaggtcgacgc & Reverse primer to order: GCGTCGACCTGCAGTTAACCGCAGTACGG
Purification Tags and Selection (Anti-biotic Resistance) • Anti-biotic resistance (working concentration) • Ampicillin (100g/mL) • Kanamycin (35g/mL) • Tetracycline HCl (10g/mL) • Chloramphenicol (170g/mL in ethanol)
Digestion of Insert and Vector • Digest with the same restriction endonucleases • Optional (recommended) step: • Treat the plasmid DNA with Antarctic phosphatase • Decreases the background by stopping self-ligation of singly cut plasmid and background re-ligation
Ligation of the Insert into the Vector + • Ligation covalently attaches the vector and the insert via a phosphodiester bond (5’phosphate and 3’ hydroxyl of the next base)
Transformation • The functional construct is now ready to be transformed into new E. coli and grown up • The new DNA isolated from the E. coli must then be sequenced to make sure that everything worked • Once the sequence is confirmed, we are ready to go!
pBluescript origin of replication A widely used plasmid cloning vector ampicillin resistance gene MCS MCS, Multiple Cloning Site
select for transformants with antibiotic • electroporation = 109-1010 colonies/g DNA • heat-shock = 105-109 colonies/g DNA)
Identifying Recombinants • based on interruption of a gene • eg., lacZ gene = b-galactosidase • intact b-galactosidase produces blue color in presence of X-gal • -complementation or blue-white screening
Blue white screening Screening by insertional inactivation of the lacZ gene Lac promoter MCS(Multiple cloning sites) Ampr pUC18 (3 kb) lacZ’ ori The insertion of a DNA fragment interrupts the ORF of lacZ’ gene, resulting in non-functional gene product that can not digest its substrate x-gal.
Recreated vector: blue transformants Recombinant plasmid containing inserted DNA: white transformants Recreated vector (no insert) Recombinant plasmid (contain insert) back
Lac promoter MCS(Multiple cloning sites) Ampr pUC18 (3 kb) lacZ’ ori SalI HincII AccI SmaI XmaI BamHI EcoRI SacI KpnI XbaI PstI SphI …ACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCA… . T h rA s n S er S e r Val Pro Gly Asp Pro Leu Glu Ser Thr Cys Arg His Ala Ser… Lac Z Multiple cloning sites Multiple restriction sites enable the convenient insertion of target DNA into a vector