1 / 3

Euk1F

PCR conditions. Cloning Set of primers used Euk1f and Eukr. Euk516 R. DGGE Set of primers used Euk1f and Euk516r-GC. Euk1F. EukR. Name Specificity Reference Sequence (5´ to 3´) E.coli positions

Télécharger la présentation

Euk1F

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. PCR conditions Cloning Set of primers used Euk1f and Eukr Euk516 R DGGE Set of primers used Euk1f and Euk516r-GC Euk1F EukR

  2. Name Specificity Reference Sequence (5´ to 3´) E.coli positions EukA Eukarya Medlin et al 1988 AACCTGGTTGATCCTGCCAGT 1-21 Euk r Eukarya Medlin et al 1988 TGATCCTTCTGCAGGTTCACCTAC 1511-1535 Euk516r-CG Eukarya ACCAGACTTGCCCTCC 516-501

  3. Picoeukaryotic succession in Blanes´98

More Related