How to characterize a single piece of DNA

1. How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) • Transform recombinant DNA molecule into bacteria • Amplify DNA by culturing transformed bacteria -Select for transformants -Use transformants for variety of purposes (e.g.expression studies, sequencing, mutational analysis, etc.)

2. Cell containing gene of interest Bacterium Gene inserted into plasmid LE 20-2 Bacterial chromosome Plasmid Gene of interest Recombinant DNA (plasmid) DNA of chromosome Plasmid put into bacterial cell Recombinant bacterium Host cell grown in culture to form a clone of cells containing the “cloned” gene of interest Protein expressed by gene of interest Gene of interest Copies of gene Protein harvested Basic research and various applications Basic research on gene Basic research on protein Gene for pest resistance inserted into plants Gene used to alter bacteria for cleaning up toxic waste Protein dissolves blood clots in heart attack therapy Human growth hor- mone treats stunted growth

3. Restriction Enzymes Used to Make Recombinant DNA • Bacterial restriction enzymes • cut DNA molecules at specific DNA sequences called restriction sites

4. Restriction site MemorizeEcoRI restriction site 5¢ 3¢ DNA 3¢ 5¢ LE 20-3 EcoRI Restriction enzyme cuts the sugar-phosphate backbones at each arrow. palindrome Sticky end DNA fragment from another source is added. Base pairing of sticky ends produces various combinations. Fragment from different DNA molecule cut by the same restriction enzyme Catalyzes phosphodiester bond between 5’ phosphate & 3’ hydroxyl group of sugar Ligation One possible combination DNA ligase seals the strands. Recombinant DNA molecule

5. Do restriction digests and ligations always work? What are the other possible undesirable outcomes?

6. What is a common strategy to select for transformed bacteria? Grow bacteria on antibiotic: only plasmid carriers will survive Clever way to select for recombinant clones Plasmid contains LacZ gene-->-galactosidase X-gal (substrate:one product is blue) Blue colonies Restriction site in LacZ gene if insert DNA fragment -galactosidase X-gal White colonies

7. lacZ gene (lactose breakdown) Bacterial cell Human cell Isolate plasmid DNA and human DNA. Restriction site LE 20-4_3 ampR gene (ampicillin resistance) Bacterial plasmid Gene of interest Sticky ends Human DNA fragments Cut both DNA samples with the same restriction enzyme. Mix the DNAs; they join by base pairing. The products are recombinant plasmids and many nonrecombinant plasmids. Recombinant DNA plasmids Introduce the DNA into bacterial cells that have a mutation in their own lacZ gene. Recombinant bacteria Plate the bacteria on agar containing ampicillin and X-gal. Incubate until colonies grow. Colony carrying recombinant plasmid with disrupted lacZ gene Colony carrying non- recombinant plasmid with intact lacZ gene Bacterial clone

8. Different goals in creating recombinant clones To examine/utilize the structure and function of a single piece of DNA. 2. To package small pieces of an entire genome: genomic DNA library To have available all the sequences in the genome for examination and use.

9. DNA libraries created using plasmids and phage and bacterial hosts LE 20-6 Foreign genome cut up with restriction enzyme or Bacterial clones Recombinant plasmids Phage clones Recombinant phage DNA Plasmid library Phage library Note: practical limit on the size of DNA cloned into a vectors (plasmid: 5-10 kbp, phage: 45 kbp)

10. How to distinguish one DNA molecule from another? Characterization of DNA by Size Agarose Gel Electrophoresis Digest DNA with restriction enzymes Load DNA into wells of agarose gel Apply electric current to fractionate DNA fragments by size In electric field with positive and negative poles, which pole will DNA be attracted to? Why?

11. Mixture of DNA molecules of differ- ent sizes Longer molecules LE 20-8 Cathode Shorter molecules Power source Gel Glass plates -DNA stained with fluorescent dye (ethidium bromide) -DNA fluoresces upon exposure to ultraviolet (UV) light Anode

12. How would you determine whether a particular gene or DNA sequence is present in your cloned DNA? Southern Blot

13. Heavy weight Restriction fragments DNA + restriction enzyme Nitrocellulose paper (blot) I I I Gel LE 20-10 Sponge Paper towels I Normal -globin allele I Sickle-cell allele I Heterozygote Alkaline solution Preparation of restriction fragments. Gel electrophoresis. Blotting. Labeled nucleic acid probe: RNA or DNA Southern Blot Analysis Probe hydrogen- bonds to fragments containing normal or mutant -globin I I I Radioactively labeled probe for -globin gene is added to solution in a plastic bag I I I Fragment from sickle-cell -globin allele Film over paper blot Fragment from normal -globin allele Paper blot Hybridization with radioactive probe. Autoradiography.

14. Why are globin DNA fragments different in size?

15. Restriction enzyme Normal b-globin allele 175 bp 201 bp Large fragment LE 20-9 Ddel Ddel Ddel Ddel Sickle-cell mutant b-globin allele 376 bp Large fragment Ddel Ddel Ddel Ddel restriction sites in normal and sickle-cell alleles of -globin gene Normal allele Sickle-cell allele Large fragment 376 bp 201 bp 175 bp Electrophoresis of restriction fragments from normal and sickle-cell alleles

16. Restriction Fragments Length Polymorphisms (RFLP) - useful in detecting disease alleles -forensics to identify individuals no two individuals are alike (exception?)

17. Defendant’s blood (D) Blood from defendant’s clothes Victim’s blood (V) LE 20-17 Do the RFLPs suggest the defendant was in contact with the victim? By themselves, do RFLPS prove she’s guilty of assault?

18. Ch 20 Genomics and Molecular Techniques • Characterization of entire genomes • Human Genome Project (HPG): • ambitious goal to sequence the entire human genome (initiated 1990; mostly complete 2003) • Other genomes also sequenced • Evolutionary relatedness of key interest ->sequence comparison

19. Chromosome bands Cytogenetic map Steps in genome mapping (chromosome map) Genes located by FISH LE 20-11 Genetic (linkage) mapping Genetic markers Physical mapping Overlapping fragments DNA sequencing

20. DNA Sequencing • Short DNA fragments sequenced by dideoxy chain-termination method

21. DNA (template strand) Primer Deoxyribonucleotides Dideoxyribonucleotides (fluorescently tagged) 3¢ 5¢ DNA chain terminators 5¢ LE 20-12 DNA polymerase 3¢ DNA (template strand) Labeled strands 3¢ 5¢ 3¢ Direction of movement of strands Laser Detector

22. Other approach to genome sequencing: • Shotgun method • Sequence random fragments of DNA • Computer program orders overlapping fragments into single continuous sequence

23. Cut the DNA from many copies of an entire chromosome into overlapping frag-ments short enough for sequencing LE 20-13 Clone the fragments in plasmid or phage vectors Sequence each fragment Order the sequences into one overall sequence with computer software

24. Can we learn important information from the genome sequence? • Genome organization • Gene expression patterns in response to - environmental change e.g. pollution, global warming -Development embryogenesis-> senescence -Disease/Health

25. Computer Analysis: Key Tool Bioinformatics -analysis and storage of biological data by computing techniques -key to management & analysis of huge data sets Example: Identification of proteins coding sequences (ORF) in genomes agatactagcagctctttcgagcatcagcatcaccgatgcatcgatcacgcgctgtttg…

26. Think of a sequence feature that a program could search for to identify ORFs.

27. ? ? ? ? ? ? ?