340 likes | 898 Vues
From Big Data to Relevant data: Ribo-seq and its applications Pasha Baranov "NGS Data after the Gold Rush“ Norwich, UK, May 2014. Porridge volume, log. time. What to sequence?. Lung cancer. Genetics: up to 2.4 higher chance than general population.
E N D
From Big Data to Relevant data: Ribo-seq and its applications Pasha Baranov "NGS Data after the Gold Rush“ Norwich, UK, May 2014 Porridge volume, log time
What to sequence? Lung cancer Genetics: up to 2.4 higher chance than general population. 80-90% of lung cancer cases attributed to smoking. DNA RNA-seq Median age of lung cancer occurrence in US is 70 years. RNA ? Protein
Ribosomal profiling (ribo-seq) Ingolia et al (2009) Science 324: 218-23 Lysis, RNA digestion
Ribosomal profiling (ribo-seq) Ingolia et al (2009) Science 324: 218-23 Lysis, RNA digestion Density gradient or cushion separation
Ribosomal profiling (ribo-seq) Ingolia et al (2009) Science 324: 218-23 Lysis, RNA digestion Density gradient or cushion separation Decircularization Adaptor ligation RT PCR Circularization Differential gene expression analysis Alignment to a reference sequence Sequencing
mRNA level is only approximation of protein synthesis Immediate response to oxidative stress (1 hour) Andreev et al 2014 submitted
How do you know what is translated? CTGGAAGAAGTAAACGCCGAGCTGGAACAGCCGGATGTCTGGAACGAACC G R S K R RA G T A G C L E R T Frame 1 L E EV N A E L E Q P D V W N E P Frame 2 W K K* T P S W N S R M S G T N P Frame 3
Triplet periodicity CAGCTAGTGCGTGCTGTC 123123123123123123
Triplet periodicity CAGCTAGTGCGTGCTGTC 123123123123123123
Triplet periodicity CAGCTAGTGCGTGCTGTC 123123123123123123
Triplet periodicity CAGCTAGTGCGTGCTGTC 123123123123123123
Triplet periodicity CAGCTAGTGCGTGCTGTC 123123123123123123
Triplet periodicity CAGCTAGTGCGTGCTGTC 123123123123123123
Triplet periodicity N+1 N+2 N+3
Switches between reading frames can be seen on ribosome profiles Human Antizyme 1 mRNA Michel et al 2012 Genome Res 22:2219-2229
uORFs & nORFs Michel et al 2012 Genome Res 22:2219-2229
GWIPS-viz http://gwips.ucc.ie
Acknowledgments Dual coding: Audrey Michel University College Cork: Choudhury, Atkins Berkley: Ingolia Cambridge: Firth GWIPS-viz team: Audrey Michel Gearoid Fox Patrick O'Connor Stephen Heaphy Paddy Mullan Claire Donohue Romika Saini Zena Abbas Oxidative stress work: Dmitry Andreev Patrick O’Connor Moscow State University: Terenin, Dmitriev, Shatsky Trinity College Dublin: Kenny, Fahey, Cormican, Morris Financial resources: