160 likes | 276 Vues
This study examines the relationship between the Thr92Ala polymorphism in the Type 2 Deiodinase gene (DIO2) and insulin resistance among the Old Order Amish community. With a significant proportion of the population affected by diabetes, understanding genetic influences on insulin sensitivity is crucial. The research employed PCR and RFLP analysis to compare genotypes within a well-characterized Amish cohort. Findings indicate a possible linkage between genetic variants and insulin resistance, emphasizing the role of lifestyle and genetic backgrounds in diabetes outcomes.
E N D
Determining The Association Between the Thr92Ala Type 2 Deiodinase Polymorphism and Insulin Resistance in theOld Order Amish Matt Thomas
Impact of Diabetes • 17 Million in the U.S. Have Diabetes • 6.2% of the total population • Sixth leading cause of death in 1999 • Complications • Heart disease, stroke, high blood pressure, blindness, kidney disease, amputations • Total cost of diabetes was $98 billion in 1997 Source: http://www.niddk.nih.gov/
Prevalence of Diabetes Source: http://www.cdc.gov/diabetes/statistics/
Type 2 Diabetes • Comprises 90-95% of all diabetes cases • Develops later in life • Usually caused by insulin resistance • Results in hyperglycemia • Complex disease • Both genetic and environmental factors
Thyroid Hormone Action • Thyroid hormone plays an important role in glucose metabolism • Triiodothyronine (T3) stimulates GLUT 4 transcription • GLUT4 promotes cellular internalization of glucose
I 3’ I 3 DIO2 O R HO O R HO 5’ I 5 I 5’ I 5 T3 T4 Type 2 Deiodinase (DIO2) • DIO2 catalyzes the deiodination of the outer phenol ring of T4 into T3 • Regulates T3 concentrations in brown fat, muscle and pituitary tissue I 3’ I 3
Thr92Ala DIO2 Polymorphism • Polymorphism results from an AG transition at nucleotide 274 • Threonine is substituted by Alanine at codon 92 • Previous studies • Thr92Ala strongly associated with decreased glucose disposal
Why Study the Old Order Amish (OOA)? • Amish Family Diabetes Study began in 1995 • Detailed phenotypic characterization • OOA are a closed founder group • Large families • Nearly complete genealogies • Homogeneous lifestyles
Polymerase Chain Reaction (PCR) • Genomic DNA extracted from blood samples • Master mix: • Taq polymerase, PCR buffer, MgCl2, primers • Ran samples 40 cycles in thermocycler • Sense primer: • 5’ CTCAGGGCTGGCAAAGTCAAG 3’ • Antisense primer: • 5’ CCACACTCTATTAGAGCCATTG 3’
Restriction Fragment Length Polymorphism (RFLP) Analysis • Thr92Ala polymorphism results from an AG transition at nucleotide 274 • Transition introduces a BsgI site • Digest PCR product with restriction enzyme BsgI 5’ . . . G T G C A (N)16 . . . 3’ 5’ . . . C A G T C (N)14 . . . 5’
RFLP Results • Thr92 homozygote = One band (256 bp) • Thr92Ala heterozygote = Three bands (256, 186 & 70 bp) • Ala92 homozygote = Two bands (186 & 70 bp) 2.5% agarose gel
Thr92 homozygote = 11 Thr92Ala heterozygote = 12 Ala92 homozygote = 22 Sample Data
Screened 1269 (90%) of 1407 samples Sample of OOA subjects was found to be in Hardy-Weinberg equilibrium (p=0.993) Results
Results (cont.) • Insulin secretion and insulin area under the curve (IAUC) are significantly lower for those having a higher prevalence of Ala92 • Total cholesterol is significantly higher for those having a higher prevalence of Ala92
Conclusion • Results conflict with previous findings • Vermont studies found decreased glucose disposal for Ala92 polymorphism • Differences may be due to population differences • Amish have physically active lifestyles • Linkage disequilibrium • Different evaluations of insulin resistance
Acknowledgements • Dr. Francesco Celi • Dr. Alan R. Shuldiner • Dr. Daniela Mentuccia