vin
Uploaded by
16 SLIDES
279 VUES
160LIKES

Association of Thr92Ala Type 2 Deiodinase Polymorphism with Insulin Resistance in the Amish

DESCRIPTION

This study examines the relationship between the Thr92Ala polymorphism in the Type 2 Deiodinase gene (DIO2) and insulin resistance among the Old Order Amish community. With a significant proportion of the population affected by diabetes, understanding genetic influences on insulin sensitivity is crucial. The research employed PCR and RFLP analysis to compare genotypes within a well-characterized Amish cohort. Findings indicate a possible linkage between genetic variants and insulin resistance, emphasizing the role of lifestyle and genetic backgrounds in diabetes outcomes.

1 / 16

Télécharger la présentation

Association of Thr92Ala Type 2 Deiodinase Polymorphism with Insulin Resistance in the Amish

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Determining The Association Between the Thr92Ala Type 2 Deiodinase Polymorphism and Insulin Resistance in theOld Order Amish Matt Thomas

  2. Impact of Diabetes • 17 Million in the U.S. Have Diabetes • 6.2% of the total population • Sixth leading cause of death in 1999 • Complications • Heart disease, stroke, high blood pressure, blindness, kidney disease, amputations • Total cost of diabetes was $98 billion in 1997 Source: http://www.niddk.nih.gov/

  3. Prevalence of Diabetes Source: http://www.cdc.gov/diabetes/statistics/

  4. Type 2 Diabetes • Comprises 90-95% of all diabetes cases • Develops later in life • Usually caused by insulin resistance • Results in hyperglycemia • Complex disease • Both genetic and environmental factors

  5. Thyroid Hormone Action • Thyroid hormone plays an important role in glucose metabolism • Triiodothyronine (T3) stimulates GLUT 4 transcription • GLUT4 promotes cellular internalization of glucose

  6. I 3’ I 3 DIO2 O R HO O R HO 5’ I 5 I 5’ I 5 T3 T4 Type 2 Deiodinase (DIO2) • DIO2 catalyzes the deiodination of the outer phenol ring of T4 into T3 • Regulates T3 concentrations in brown fat, muscle and pituitary tissue I 3’ I 3

  7. Thr92Ala DIO2 Polymorphism • Polymorphism results from an AG transition at nucleotide 274 • Threonine is substituted by Alanine at codon 92 • Previous studies • Thr92Ala strongly associated with decreased glucose disposal

  8. Why Study the Old Order Amish (OOA)? • Amish Family Diabetes Study began in 1995 • Detailed phenotypic characterization • OOA are a closed founder group • Large families • Nearly complete genealogies • Homogeneous lifestyles

  9. Polymerase Chain Reaction (PCR) • Genomic DNA extracted from blood samples • Master mix: • Taq polymerase, PCR buffer, MgCl2, primers • Ran samples 40 cycles in thermocycler • Sense primer: • 5’ CTCAGGGCTGGCAAAGTCAAG 3’ • Antisense primer: • 5’ CCACACTCTATTAGAGCCATTG 3’

  10. Restriction Fragment Length Polymorphism (RFLP) Analysis • Thr92Ala polymorphism results from an AG transition at nucleotide 274 • Transition introduces a BsgI site • Digest PCR product with restriction enzyme BsgI 5’ . . . G T G C A (N)16 . . . 3’ 5’ . . . C A G T C (N)14 . . . 5’

  11. RFLP Results • Thr92 homozygote = One band (256 bp) • Thr92Ala heterozygote = Three bands (256, 186 & 70 bp) • Ala92 homozygote = Two bands (186 & 70 bp) 2.5% agarose gel

  12. Thr92 homozygote = 11 Thr92Ala heterozygote = 12 Ala92 homozygote = 22 Sample Data

  13. Screened 1269 (90%) of 1407 samples Sample of OOA subjects was found to be in Hardy-Weinberg equilibrium (p=0.993) Results

  14. Results (cont.) • Insulin secretion and insulin area under the curve (IAUC) are significantly lower for those having a higher prevalence of Ala92 • Total cholesterol is significantly higher for those having a higher prevalence of Ala92

  15. Conclusion • Results conflict with previous findings • Vermont studies found decreased glucose disposal for Ala92 polymorphism • Differences may be due to population differences • Amish have physically active lifestyles • Linkage disequilibrium • Different evaluations of insulin resistance

  16. Acknowledgements • Dr. Francesco Celi • Dr. Alan R. Shuldiner • Dr. Daniela Mentuccia

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer