110 likes | 209 Vues
Learn about DNA replication, a vital process for cell division, with the involvement of enzymes like DNA Helicase and DNA Polymerase. Understand how newly synthesized DNA duplicates exactly as the parent DNA. Follow along for an interactive replication demonstration with base-pairing and enzyme interactions.
E N D
Replicated/Synthesized DNA • Necessary: • Cell division into new cells (mitosis) • meiosis (gamete formation)
DNA Replication (Copying) ** Newly synthesized DNA is EXACTLY the same as the parent DNA…Remember S phase of Interphase!!
The *Enzyme DNA Helicase(Yellow Below) Unzips the DNA Into Two Strands **One strand is copied forward, the other backward! *We’ll look at enzymes more closely later on!!!
Base-Pairing Occurs With the DNA Strands ** Remember, A’s and T’s pair, C’s and G’s pair
Replicate the Following DNA Strand Into A New Strands ATGCGCTTAGGCGTCCGGTAAGTCGATCGAT T A C G C G A A T C C G C A G G C C A T T C A G C T A G C T A A’s and T’s pair, C’s and G’s pair