wendi
Uploaded by
8 SLIDES
273 VUES
90LIKES

ITR 5’

DESCRIPTION

ORF codant la transposase (Tnp). ITR 5’. ITR 3’. Hsmar1:. miHsmar1 (80 pb). ccd B +. ccd B +. KanaR. KanaR. pUC ori. pUC ori. a. pDONR221-CmR -. ITR3pA. mini-Mos1. Random Integrations in the pDONR221-CmR -. lacZ’. AmpR. pUC ori.

1 / 8

Télécharger la présentation

ITR 5’

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. ORF codant la transposase (Tnp) ITR5’ ITR 3’ Hsmar1: miHsmar1 (80 pb)

  2. ccdB+ ccdB+ KanaR KanaR pUC ori pUC ori a. pDONR221-CmR- ITR3pA mini-Mos1 Random Integrations in the pDONR221-CmR- lacZ’ AmpR pUC ori Selection of the transposition events in ccdB- by tranfecting in DH5 bacteria and plating on LB-kanamycin petri dishes b. Position TA location in ccdB 1170-tggctgtgTATCAGG/clone1/CCTGATAtaagggag (ccdB 3’UTR) 1189-ctgacattTATCAGG/clone2/CCTGATAtattcccc (ccdB stop codon) 1211-catcaggtTATCAGG/clone3/CCTGATAatggcgtt (ccdB ORF) 1471-ctcttttaTATCAGG/clone4/CCTGATAggtgtaaa (ccdB ORF) 1477-tataggtgTATCAGG/clone5/CCTGATAaaccttaa (ccdB ORF)

  3. a. 87 1 2 3 4 5 6 57 113 1 74 18 130 91 35 147 108 52 164 126 70 182 143 87 199 Rf 0.22 0.20 0.18 0.16 0.14 0.12 0.10 c. 50 70 90 110 130 150 Probe Center d. 3’ITR (TA)TCAGGTGTACAAGTATGAAATGTCGTTT 5’ITR (TA)cCAGGTGTACAAGTAgGgAATGTCGgTT 104 107 1 2 3 4 5 6 b. Probes Complexes Free ITR

  4. PEC1 G+A PEC1 SEC2 SEC2 G+A g a t c c t a a c g c t t g a g g a A t T c A T G A T T C C C A A G C G A T G T T G A T C T A C A A G T T A A T C G T A T A T A A T C G A T C G G C T A * T A 5’ 5’ TA T A TA * 5’ 5’ c g t Non Transferred strand Transferred strand a. b. 5’ gaactagtggatc TA TCAGGTGTACAAGTATGAAATGTCGTTTgatc 3’ (NT) 3’ cttgatcacctag AT AGTCCACATGTTCATACTTTACAGCAAActag 5’ (T)

  5. Mos1  + + + + 5’ nnnTAT+1C+2A+3GGTGT… 3’ (NT) 3’ nnnATA+1G+2T+3CCACA… 5’ (T)    + * * * * 5’ nnnTAA+1C+2A+3GGTTG… 3’ (NT) 3’ nnnATT+1G+2T+3CCAAC… 5’ (T) Himar1 * Hsmar1 * * * 5’ nnnTAT+1T+2A+3GGTTG… 3’ (NT) 3’ nnnATA+1A+2T+3CCAAC… 5’ (T) * * *

  6. a. b. c. d.

  7. Mobilité des Packs miHsmar1 Question caduque

  8. Evolution du projet dans Modulome Fabriquer un outil pour inventorier les miHsmar1 dans les génomes de primates

More Related