460 likes | 595 Vues
Dynamic Programming Algorithms II. Mohammed Aledhari Bioinformatics / data mining Thursday May 23 rd , 2013 . Outline. Local Sequence Alignment Alignment with Gap Penalties Multiple Alignment Gene Prediction Statistical Approaches to Gene Prediction
E N D
Dynamic Programming Algorithms II Mohammed Aledhari Bioinformatics/ data mining ThursdayMay 23rd, 2013
Outline • Local Sequence Alignment • Alignment with Gap Penalties • Multiple Alignment • Gene Prediction • Statistical Approaches to Gene Prediction • Similarity-Based Approaches to Gene Prediction • Conclusion • References
The Local Alignment Problem • Goal: Find the best local alignment between two strings • Input : Strings v, w and scoring matrix δ • Output : Alignment of substrings of v and w whose alignment score is maximum among all possible alignment of all possible substrings
Local Alignments: Why? • Two genes in different species may be similar over short conserved regions and dissimilar over remaining regions. • Example: • Homeobox genes have a short region called the homeodomain that is highly conserved between species. • A global alignment would not find the homeodomain because it would try to align the ENTIRE sequence
Compute a “mini” Global Alignment to get Local Local Alignment: Example Local alignment Global alignment
Local Alignment: Free Rides Yeah, a free ride! Vertex (0,0) The dashed edges represent the free rides from (0,0) to every other node.
This is more likely. This is less likely. Affine Gap Penalties • In nature, a series of kindels often come as a single event rather than a series of k single nucleotide events: ATA__GC ATATTGC ATAG_GC AT_GTGC Normal scoring would give the same score for both alignments
Adding “Affine Penalty” Edges to the Edit Graph There are many such edges! Adding them to the graph increases the running time of the alignment algorithm by a factor of n (where n is the number of vertices) So the complexity increases from O(n2) to O(n3)
Multiple Alignment versus Pairwise Alignment • Up until now we have only tried to align two sequences. • What about more than two? And what for? • A faint similarity between two sequences becomes significant if present in many • Multiple alignments can reveal subtle similarities that pairwise alignments do not reveal
Generalizing the Notion of Pairwise Alignment • Alignment of 2 sequences is represented as a 2-row matrix • In a similar way, we represent alignment of 3 sequences as a 3-row matrix A T _ G C G _ A _ C G T _ A A T C A C _ A • Score: more conserved columns, better alignment
Alignment Paths • Align 3 sequences: ATGC, AATC,ATGC x coordinate y coordinate z coordinate • Resulting path in (x,y,z) space: • (0,0,0)(1,1,0)(1,2,1) (2,3,2) (3,3,3) (4,4,4)
Aligning Three Sequences source • Same strategy as aligning two sequences • Use a 3-D “Manhattan Cube”, with each axis representing a sequence to align • For global alignments, go from source to sink sink
2-D vs 3-D Alignment Grid V W 2-D edit graph 3-D edit graph
2-D cell versus 2-D Alignment Cell In 2-D, 3 edges in each unit square In 3-D, 7 edges in each unit cube
Architecture of 3-D Alignment Cell (i-1,j,k-1) (i-1,j-1,k-1) (i-1,j,k) (i-1,j-1,k) (i,j,k-1) (i,j-1,k-1) (i,j,k) (i,j-1,k)
Multiple Alignment: Running Time • For 3 sequences of length n, the run time is 7n3; O(n3) • For ksequences, build a k-dimensional Manhattan, with run time (2k-1)(nk); O(2knk) • Dynamic programming approach for alignment between two sequences is easily extended to k sequences but it is impractical due to exponential running time
Greedy Approach: Example • Consider these 4 sequences s1 GATTCA s2 GTCTGA s3 GATATT s4 GTCAGC
Greedy Approach: Example (cont’d) • There are = 6 possible alignments s2GTCTGA s4GTCAGC (score = 2) s1 GAT-TCA s2 G-TCTGA (score = 1) s1 GAT-TCA s3 GATAT-T (score = 1) s1 GATTCA-- s4 G—T-CAGC(score = 0) s2G-TCTGA s3GATAT-T (score = -1) s3GAT-ATT s4G-TCAGC (score = -1)
Greedy Approach: Example (cont’d) s2 and s4 are closest; combine: s2GTCTGA s4GTCAGC s2,4GTCt/aGa/cA(profile) new set of 3 sequences: s1 GATTCA s3 GATATT s2,4GTCt/aGa/c
Gene Prediction • Gene Prediction is the process of detection of the location of open reading frames (ORFs) and delineation of the structures of introns as well as exons if the genes of interest are of eukaryotic origin. • The ultimate goal is to describe all the genes computationally with near 100% accuracy
Gene • Genes are the functional and physical unit of heredity passed from parent to offspring. • Gene: A sequence of nucleotides coding for protein • Gene Prediction Problem: Determine the beginning and end positions of genes in a genome • Genes are pieces of DNA, and most genes contain the information for making a specific protein.
DNA transcription RNA translation Protein Central Dogma: DNA -> RNA -> Protein CCTGAGCCAACTATTGATGAA CCUGAGCCAACUAUUGAUGAA PEPTIDE Central Dogma simple idea
Central Dogma and Splicing intron1 intron2 exon2 exon3 exon1 transcription splicing translation exon = coding intron = non-coding Batzoglou
Coding v/s Noncoding Coding region Noncoding region Noncoding regions are the parts of DNA which do not encode protein sequences. They may or may not be transcribed into RNA. E.g.: tRNA, rRNA, sRNA genes Coding regions are the parts of DNA which will give rise to a mature messenger RNA that will be translated into the specific amino acids of the protein product
Two Approaches to Gene Prediction • Statistical: coding segments (exons) have typical sequences on either end and use different subwords than non-coding segments (introns). • Similarity-based: many human genes are similar to genes in mice, chicken, or even bacteria. Therefore, already known mouse, chicken, and bacterial genes may help to find human genes.
Gene Prediction Methods • Gene Prediction represents one of the most difficult problems in the field of pattern recognition, particularly in the case of eukaryotes • The principle difficulties are: • Detection of initiation site (AUG) • Alternative start codons • Gene overlap • Undetected small proteins
Gene Prediction Methods ACGTACTACGTACGTACGTACGATCGATCGATCGATCGATCGACTGATCGATCGATCGATCGTACGTAGCGACTGACTGACTGATCGACTACGTAGCTGCAGTCAGTCGACTGACTGACTA Ab-initio methods Ab-initio methods Homology based methods
Ab-initio Methods • Predicts gene based on the given sequence alone. • Consists of two types of models: • Markov based models • Dynamic Programming
A brief introduction of HMMs • Hidden Markov models (HMMs) are discrete Markov processes where every state generates an observation at each time step. • A hidden Markov model (HMM) is statistical Markov model in which the system being modeled is assumed to be a Markov process with unobserved (hidden) states.
From Markov Model to HMM • HMMs are discrete Markov processes where each state also emits an observation according to some probability distribution, we need to augment our model. • Parameters • Initial state probabilities: πi • State transition probabilities: aij • Emission probabilities: ei(k)
Genetic Code and Stop Codons UAA, UAG and UGA correspond to 3 Stop codons that (together with Start codon ATG) delineate Open Reading Frames
Stop-start Frames in a DNA Sequence • stop codons – TAA, TAG, TGA • start codons - ATG CTGCAGACGAAACCTCTTGATGTAGTTGGCCTGACACCGACAATAATGAAGACTACCGTCTTACTAACAC CTGCAGACGAAACCTCTTGATGTAGTTGGCCTGACACCGACAATAATGAAGACTACCGTCTTACTAACAC CTGCAGACGAAACCTCTTGATGTAGTTGGCCTGACACCGACAATAATGAAGACTACCGTCTTACTAACAC CTGCAGACGAAACCTCTTGATGTAGTTGGCCTGACACCGACAATAATGAAGACTACCGTCTTACTAACAC GACGTCTGCTTTGGAGAACTACATCAACCGGACTGTGGCTGTTATTACTTCTGATGGCAGAATGATTGTG GACGTCTGCTTTGGAGAACTACATCAACCGGACTGTGGCTGTTATTACTTCTGATGGCAGAATGATTGTG GACGTCTGCTTTGGAGAACTACATCAACCGGACTGTGGCTGTTATTACTTCTGATGGCAGAATGATTGTG GACGTCTGCTTTGGAGAACTACATCAACCGGACTGTGGCTGTTATTACTTCTGATGGCAGAATGATTGTG
Gene Prediction Tools • GENSCAN/Genome Scan • TwinScan • Glimmer • GenMark
The GENSCAN Algorithm • Algorithm is based on probabilistic model of gene structure similar to Hidden Markov Models (HMMs). • GENSCAN uses a training set in order to estimate the HMM parameters, then the algorithm returns the exon structure using maximum likelihood approach standard to many HMM algorithms (Viterbi algorithm). • Biological input: Codon bias in coding regions, gene structure (start and stop codons, typical exon and intron length, presence of promoters, presence of genes on both strands, etc) • Covers cases where input sequence contains no gene, partial gene, complete gene, multiple genes.
GENSCAN Limitations • Does not use similarity search to predict genes. • Does not address alternative splicing. • Could combine two exons from consecutive genes together
GenomeScan • Incorporates similarity information into GENSCAN: predicts gene structure which corresponds to maximum probability conditional on similarity information • Algorithm is a combination of two sources of information • Probabilistic models of exons-introns • Sequence similarity information
TwinScan • Aligns two sequences and marks each base as gap ( - ), mismatch (:), match (|), resulting in a new alphabet of 12 letters: Σ {A-, A:, A |, C-, C:, C |, G-, G:, G |, T-, T:, T|}. • Run Viterbi algorithm using emissions ek(b) where b∊ {A-, A:, A|, …, T|}.
TwinScan (cont’d) • The emission probabilities are estimated from from human/mouse gene pairs. • Ex. eI(x|) < eE(x|) since matches are favored in exons, and eI(x-) > eE(x-) since gaps (as well as mismatches) are favored in introns. • Compensates for dominant occurrence of poly-A region in introns
Glimmer • Gene Locator and Interpolated Markov ModelER • Finds genes in bacterial DNA • Uses interpolated Markov Models
The Glimmer Algorithm • Made of 2 programs • BuildIMM • Takes sequences as input and outputs the Interpolated Markov Models (IMMs) • Glimmer • Takes IMMs and outputs all candidate genes • Automatically resolves overlapping genes by choosing one, hence limited • Marks “suspected to truly overlap” genes for closer inspection by user
GenMark • Based on non-stationary Markov chain models • Results displayed graphically with coding vs. noncoding probability dependent on position in nucleotide sequence
Useful internet gene prediction resources • http://www.nslij-genetics.org/gene/ • http://dot.imgen.bcm.tmc.edu:9331/seq-search/gene-search.html • http://genome.cs.mtu.edu/aat.html • http://bioweb.pasteur.fr/seqanal/interfaces/cds-simple.html • http://genomic.sanger.ac.uk/gf/gf.shtml • http://searchlauncher.bcm.tmc.edu:9331/seq-search/gene-search.html
Conclusion Local sequence alignment, Alignment with gap penalties, Multiple alignment, Gene prediction, Statistical approaches to gene prediction, Similarity-Based approaches to gene prediction
References • http://bix.ucsd.edu/bioalgorithms/ (text book website) • http://biochem218.stanford.edu/ • http://www.cs.washington.edu/education/courses/cse527/09au/ • http://stellar.mit.edu/S/course/6/fa09/6.047/index.html
Questions & comments Thank you