Evolution and its Significance in the Sciences

1. Evolution and its Significancein the Sciences • Introduction and Revolutions • Historical context of evolution • Theory of Evolution: mechanism of action • Origin and evolution of life • Evolution in 2015 • Evolution in perspective of the sciences

2. Introduction • Two sides of the same coin: diversity and similarity • Theory of evolution • Species evolve gradually over time • Mechanism is natural selection • Gift to biology • Unifying theory to explain diversity and similarity • Theory underpinning all of the life sciences (ecology, environmental sciences, genetic engineering, molecular genetics, astrobiology, epidemic diseases, etc.)

3. Revolutions in the Sciences: A Stroll through Time • Notable revolutions • Copernicus • Newton • Rutherford and Bohr • Vegener • Hubble • Darwin • Einstein • Watson and Crick • Attributes of revolutions • Challenged existing science/ideas with heated debates • Challenged concept of spatial dimension of natural world (e.g., universe, sun, flatness of Earth) • Challenged concept of the time dimension of natural world (e.g., Hubble) • Challenged static/fixed view of natural world • Many more revolutions to come … but pattern consistent with the above

4. Evolution’s Place in the Life Science • Theodosius Dobzhansky “Nothing in biology makes sense except in the light of evolution” (1973) • Genetics of inheritance (e.g., dominance and recessive traits, 3:1 ratio) • Medicine (e.g., mismatched diseases, transplant surgeries) • Ecology/environmental science (e.g., biodiversity) • Genetic engineering (e.g., mutations, excision/repair, aging) • Molecular genetics (e.g., genetic code, DNA, RNA)

5. Historical Context: Darwin • Voyage of the Beagle on the HMS Beagle (1831) • Age 22 as naturalist (theologian) • Convention at the time: • Static view of nature • The Earth is young (1,000’s of years) • Frame of reference for Darwin: UK landscape and biodiversity as bland as UK food http://www.sciencenews.org/view/feature/id/40014/title/Darwins_Evolution http://www.youtube.com/watch?v=rzjHA2eEsCI

6. Notable Observations by Darwin: HMS Beagle • South American diversity of landscapes and biota • Brazilian rainforest • Savannas of Argentina • Dry deserts of Terra del Fuego • Towering Andes mountains • Many structures with intuitive value in the environment (adaptations) • Seeding of idea: living systems are not static but vary in accordance with the environment

7. What are These Adaptations? Deserts Tropical Rainforests Bipedalism Grasslands - Lama

8. Galapagos Islands and Darwin

9. Observations on the Galapagos • Galapagos Islands: the seminal event • Volcanic islands off Ecuador (500 km) • Fauna (birds, tortoises, etc.) • Recognized lineage to species on S. American mainland (e.g., finches, tortoise), but different • Seeding of idea for a mechanism • Fauna arrived from mainland • Fauna diversified over time in new environment of Galapagos showing unique adaptations Darwin’s Finches Galapagos Tortoise

10. Darwin and Natural Selection (1840’s) • Idea No. 1: Organisms differ in their adaptations and success in reproduction and therefore contribute differently to future generations • Idea No. 2: Driving force for this differential success is natural selection acting on the variability among individuals • Product: evolution of adaptations enhancing success (fitness) • Seminal text: On the Origin of Species (1859) • Note: genetics of inheritance unknown – Mendel in 1860’s

11. Heads: The Impressive Diversity Hi! You look a bit better today than last week!

12. Tails: The Impressive Similarity 100 95 82 70 55 14 Your DNA = 90% Pig!

13. Question While Darwin published many treatises in his lifetime, the most influential was entitled ____ and released in 1859. • The Zoology of the Voyage of the H.M.S. Beagle • The geology of the Voyage of the H.M.S. Beagle • On the Origin of Species • Descent of man • Variations Under Domestication

14. Question Any structure or physiological process that helps an animal, plant or microbe survive in its environment is called a/an ___. • fitness component • adaptation • asset • liability

15. Question After observing the varied landscapes and plants and animals of the South American mainland, Darwin surmised that living systems are not ___ but change as the environment changes. • static • related to one another • camouflaged • variable over space

16. Evolution: the Mechanism • Populations and species evolve (hierarchy) Kingdom Family Species Populations Individuals • Evolution at the population level = microevolution • Evolution at the species level and above = macroevolution • Both based on genetic changes over time • Do individuals evolve?

17. Macroevolution: The Evolution of the Horse (An Example)

18. Mechanism: Concept of Fitness • Fitness = relative contribution of an individual to the next generation • Given two individuals of dissimilar physical size (robust vs. small stature) and the smaller individual with more offspring, which individual is more fit in an evolutionary sense?

19. Summary of Mechanism (1940’s) • Two cardinal tenets • Natural selection (Darwin) • Individuals differ genetically in fitness (Mendel - decades later; Watson and Crick – 100 years later!) • Result: Gene pool of the next generation a consequence of the action of natural selection on inherited variation at the level of populations, with some alleles (i.e., traits) contributing more to the next generation …. microevolution Over time (1,000 to 100,000’s of years) evolution of new species (speciation) … macroevolution

20. First Generation Gene Pool Second Generation Gene Pool N>100 Generations Gene Pool N>1000 Generations Gene Pool

21. Gradual Speciation over Time 10,000 to 100,000’s Years 1 - 60 Million Years

22. Evidence for Evolution • Fossil record in geological strata • Anatomy • Molecular genetics • Genetic relatedness • Ongoing examples of evolution

23. Fossil Evidence: Reptiles to Birds • Examples • Evolution of the horse (2 slides ago) • Evolution of humankind (bit later) • Evolution of birds • Macroevolution from the dinosaur lineage! Archaeopteryx I am back!

24. Anatomical Similarities Among Animals Embryos

25. Molecular Genetics is the Same in All Life Forms ATP: Universal Energy Currency Remember: The Genetic Code of Molecular Genetics and Why Viruses are so Successful? DNA: Universal “information broker”

26. Evidence: Genetic Relatedness HUMANCCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA CHIMPANZEECCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGA GORILLA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA

27. Question Evolution that plays out at the level of populations of plants, animals or microbes is referred to as ___. A. population evolution • macroevolution • phyletic evolution • microevolution

28. Question Microevolution and macroevolution are recognized by evolutionary biologists because the mechanism underlying each is distinct from that of the other. • True • False

29. Question Any feature (structure, physiology) of a plant, animal or microbe that enhances the individual’s genetic contribution to the next generation is best described as conferring ___. • positive • fitness • gametic • All of the above

30. Question While many think that ___ went extinct 60 million years ago, scientists now know that birds are one of the surviving lineages of this group of organisms. • monkeys • mammals • reptiles • dinosaurs

31. Evolution • Introduction • Historical context • Processes and mechanisms • Origin and evolution of life (see text) • Evolution in 2015 • Virus - H1N1 (earlier lecture) • Evolution of humans • Evolution “as you sleep” • Signs of recent human evolution • Other perspectives on the evolution of life

32. Proto-Humans and First Humans: Who, Where and When http://www.archaeologyinfo.com/species.htm

33. Evolution of Humankind “World’s oldest human-linked skeleton found: ‘Ardi’ predates Lucy by a million years, changes scientific view of origins” Science News October 2009 “Ardi” - 4.5 MY ago (MYBP)

34. Evolutionary Tree of Hominids (Bipedal Primates) Thee and me! (<100,000 YBP) Homo erectus (1 MYBP) Is this macroevolution or microevolution? Lucy (3 MYBP) Ardipithecus ramidus Ardi (4 MYBP)

35. Proto-Humans and First Humans:Who, Where and When Australopithecus afarensis “Lucy” Homo habilis Ardipithecus ramidus “Ardi” Homo erectus Homo sapiens

36. Homo neanderthalensisand Homo sapiens • Western and Central Eurasia • 200,000 - 27,000 YBP • Co-existed with Homo sapiens • Theory: out-competed by Homo sapiens • Recent theory: 1-4 % of genome of Europeans from Homo neanderthalensis

37. Recent Human Evolution: Ongoing Microevolution • Widespread evolutionary adaptations throughout the human genome from last 10,000 years (hunter/gatherer) • Genetic adaptations to diet • Diary products (lactose intolerance) in European races • Genetic adaptations to northern hemisphere migrations • Lighter skin color at higher latitudes (greater UV and vitamin D) • Changes in blood group chemistry (ABO) • Role of epidemic diseases in human history (e.g., Bubonic plague) • Each of you has ancestors (last 10,000 years) who survived multiple plagues and passed “resistant” alleles to ancestors that conferred “fitness” … 99% died due to epidemic diseases

38. Evolution in Action “As You Sleep” • Antibiotic resistance in microbes • 100+ antibiotics since 1940’s (penicillium) • Effectiveness of antibiotics • MRSA (staph infection) • Resistance to insecticides in cockroaches • “Godzilla the Cockroach” Microevolution or macroevolution?

39. Evolution and its Significancein the Sciences • Introduction and Revolutions • Historical context of evolution • Theory of Evolution: mechanism of action • Origin and evolution of life • Evolution in 2015 • Evolution in perspective of the sciences

40. Other Theories and Beliefs of Life’s Diversity and Life’s Similarity • Lamarckian Theory of Evolution (1800’s) • Inconsistent with scientific method • Creationism • Inconsistent with scientific method • Intelligent Design (ID) • Inconsistent with scientific method • Darwin’s Theory of Evolution • Consistent with scientific method

41. Evolution in Perspective of the Sciences • Unifying theory in the life sciences (theory versus law?) • Analogues in the sciences Copernicus Newton Wegner Rutherford Bohr Hubble Einstein Watson and Crick • Darwin discovered the seminal processes in the life sciences that explains (i) the breadth and diversity of life in all its forms and (ii) at the same time life’s similarities • Darwin’s theory = revolution in the life sciences

42. Evolution’s Place in the Life Science • Theodosius Dobzhansky “Nothing in biology makes sense except in the light of evolution” (1973) • Genetics of inheritance (e.g., dominance and recessive traits, 3:1 ratio) • Medicine (e.g., mismatched diseases, transplant surgeries) • Ecology/environmental science (e.g., biodiversity) • Genetic engineering (e.g., mutations, excision/repair, aging) • Molecular genetics (e.g., genetic code, DNA; RNA)

43. Question Humankind has evolved through multiple species of hominids in Africa over ____ years. • ~1,000 • ~100,000 • ~1,000,000 • ~5,000,000 • ~100,000,000

44. Question If you are of Western European origin, ___ % of your genome is thought to be that of Homo neanderthalensis. • 20 - 25 • 10 - 15 • 5 - 10 • 1 - 4 • 0

45. Question Darwin’s contribution in the life sciences is equivalent to that of ___. • Copernicus • Watson and Crick • Rutherford • Einstein • All of the above

46. Evolution and its Significance Introduction Historical context of evolution Theory of Evolution: mechanism of action Origin and evolution of life Evolution in 2015 Evolution in perspective of the sciences