yachi
Uploaded by
1 SLIDES
122 VUES
10LIKES

The Role of microRNA-874 as a Tumor Suppressor in Maxillary Sinus Squamous Cell Carcinoma

DESCRIPTION

MicroRNAs (miRNAs) play a crucial role in regulating gene expression and are implicated in various human cancers. This study focuses on miRNA-874, which has been discovered to function as a tumor suppressor in Maxillary Sinus Squamous Cell Carcinoma (MSSCC). We found that miR-874 is down-regulated in tumor tissues and negatively regulates key oncogenes. Our research indicates that high expression of miR-874 leads to decreased levels of PPP1CA, PAAF1, and TGOLN2, which have been linked to tumor growth. Understanding these mechanisms may aid in developing diagnostic and therapeutic strategies for MSSCC.

1 / 1

Download Presentation
Télécharger la présentation

The Role of microRNA-874 as a Tumor Suppressor in Maxillary Sinus Squamous Cell Carcinoma

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Role of microRNAs in human cancers MicroRNAs (miRNAs) are an abundant class of small non-protein-coding RNAs that function as negative gene regulators. They regulate diverse biological processes, and bioinformatic data indicates that each miRNA can control hundreds of gene targets, underscoring the potential influence of miRNAs on almost every genetic pathway. Recent evidence has shown that miRNA mutations or mis-expression correlate with various human cancers and indicates that miRNAs can function as tumour suppressors and oncogenes. Overexpressed miRNAs can act as oncogenes by repressing tumor suppressor genes, whereas under-expressed miRNAs can function as tumor suppressors by negatively regulating oncogenes. miRNAs have been clearly shown to repress the expression of important cancer-related genes and might prove useful in the diagnosis and treatment of cancer. Maxillary sinus squamous cell carcinoma Maxillary sinus squamous cell carcinoma (MSSCC) comprises 2-3% of all cancers of head and neck tumor and the annual incidence rate is 0.5-1.0 per 100,000 populations. Clinical symptoms of MSSCC present insidiously. Primary tumors are often diagnosed as advanced disease. The 5-years survival rate of T4 tumors is 50% around. Local recurrence is the most common cause of treatment failure and death . Abstract #4143 200 100 300 microRNA-874 as a tumor suppressor in maxillary sinus squamous cell carcinoma based on microRNA expression signature Toyoyuki Hanazawa1, Nijiro Nohata1,2, Takashi Kinoshita1,2,Naoko Kikkawa1,Miki Fuse1, Takeshi Chiyomaru3, Hirofumi Yoshinoi3, Hideki Enokida3, Masayuki Nakagawa3, Yoshitaka Okamoto1 and NaohikoSeki2 P=0.0312 P=0.0298 3.0 1Department of Otorhinolaryngology / Head and Neck Surgery, Graduate School of Medicine, Chiba University, Chiba Japan 2Department of Functional Genomics, Graduate School of Medicine, Chiba University, Chiba, Japan 3Department of Urology, Graduate School of Medical and Dental Sciences, Kagoshima University, Kagoshima, Japan 0.25 2.5 0.20 2.0 P =0.0307 4 miR-874 expression (Normalized to RNU48) 0.020 0.15 1.5 0.10 1.0 3 0.015 0.05 0.5 1. Characteristics of twenty patients with maxillary sinus squamous cell carcinoma PP1α 0 0 Normal Tumor Normal Tumor Cell number (x104) β-Actin 2 0.010 4. Down-regulated genes by miR-874 in IMC-3 cells 120 100 80 1 PP1α normalized to β-Actin 0.005 60 40 20 0 0 0 Normal Tumor 0hr 24hr 48hr 72hr 2. Top five down-regulated miRNAs from TaqManLow Density Array (n=5) 3. miR-874 expression levels and tumor suppressive function in IMC-3 cells *:P< 0.05 120 100 * 5 80 miR-control miR-874 4 60 Proliferation (% of control) Aims of this study 3 * Cell number (x104) To identify the down-regulated miRNAs based on miRNA expression signature using clinical specimens of maxillary sinus squamous cell carcinoma. To elucidate the functional significance of microRNA-874 (miR-874) in maxillary sinussquamous cell carcinoma. To find candidate target genes of tumor suppressive miR-874 by performing genome-wide analysis (microarray analysis and web-based program search). 40 5. Three candidate genes were overexpressed in tumor and were inversely correlated with miR-874 expression 2 20 1 0 0 0hr 24hr 48hr 72hr rs=-0.465 P=0.002 control miR-874 6. miR-874 directly regulated PPP1CA expression in both mRNA and protein levels miR-control 120 *:P< 0.05 PPP1CA mRNA expression (% of miR-control) miR-874 PPP1CA (NM_001008709) 3’UTR length:353 Overexpressed miRNAs as oncogenes Underexpressed miRNAs as tumor suppressors 100 miR-874 target sites 237-243 80 rs=-0.477 P=0.002 PPP1CA mRNA expression PAAF1 mRNA expression TGOLN2 mRNA expression * 60 P=0.0154 5‘ ...GCCGAGGCUGCAGCUCAGGGCAA...                     ||||||| 3’     AGCCAGGGAGCCCGGUCCCGUC 40 6.0 Position 237-243 5.0 20 4.0 5‘ ...GCCGAGGCUGCAGCU-------A...                     ||||||| 3’     AGCCAGGGAGCCCGGUCCCGUC Position 237-243deletion Normalized to GUSB Normalized to GUSB Normalized to GUSB 3.0 Take home notes 0 2.0 1.2 1.0 7. si-PPP1CAinhibited cell growth in IMC-3 cells We revealed that miR-874 was down-regulated in tumor tissues and functioned as a tumor suppressor based on miRNA expression signature of clinical specimens of maxillary sinus squamous cell carcinoma. Genome-wide expression analysis using miR-874transfectants revealed that PPP1CA, PAAF1 and TGOLN2 were overexpressed in tumor tissues and were inverselycorrelated with miR-874 expression in clinical samples. miR-874directly regulated PPP1CA expression in both mRNA and protein levels. Knockdown of PPP1CAby siRNA inhibited cell proliferation in IMC-3 cells. The PP1a catalytic subunit can form complexes with many regulatory subunits, which regulate various cellular activities such as cell cycle, apoptosis, and signal transduction. 1.0 0 Normal Tumor (%) 0.8 rs=-0.464 P=0.003 120 ***:P<0.0001 Luminescence (normalized) Cell viability (% of si-control) 0.6 si-control * 100 si-PPP1CA_1 0.4 *** si-PPP1CA_2 80 0.2 * *** ** 0 60 237-243 wild type 237-243 deletion 40 *:P< 0.05 20 0 si-control *:P<0.0018, **:P<0.0005 AACR 103rdANNUAL MEETING, Tuesday April 3, 2012, 1:00 PM – 5:00 PM si-PPP1CA_1 si-PPP1CA_2

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer