yestin
Uploaded by
65 SLIDES
902 VUES
660LIKES

MOLECULAR COMPUTING

DESCRIPTION

MOLECULAR COMPUTING. DNA COMPUTING Donald Riggs. Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion. Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion. DNA Computing. DNA Computing. Introduction

1 / 65

Télécharger la présentation

MOLECULAR COMPUTING

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. MOLECULAR COMPUTING DNA COMPUTING Donald Riggs

  2. Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion DNA Computing

  3. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion Two types of molecular computing: • Specially created molecules - Rotaxane • Wire into grid - FPGA • Configure to form logic gates • DNA computing

  4. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion

  5. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion Watson-Crick Complemetarity • Base pairs only join together in one way • Pairing rules • Adenine –Thymine • Guanine – Cytosine Directionality • left to right, from 5’ – 3’ 5' A T C G 3' | | | | 3' T A G C 5'

  6. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion 5' A T C G 3' | | | | 3' T A G C 5' A strand beginning with a 5' end will only combine with a complementary strand beginning with a 3' end, thus the following binding is not possible. 5' A T C G 3' | | | | 5' T A G C 3'

  7. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion The tripartite chemical structure of a nucleotide, the basic building block of a DNA molecule, shown here with a thymine base. [Paun et al, 1998]

  8. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion A schematic representation of double stranded DNA showing the “directionality” of each of the two strands.[Paun et al, 1998]

  9. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion Polymerase – produces the complement of a single DNA strand. Requires a primer. Ligase – joins strands of DNA together covalently. Not the same as hydrogen bonds which join bases together.

  10. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion Annealing – formation of double-stranded DNA from single strands. Denaturation – separation of a double-stranded DNA molecule into two single-strands.

  11. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion Polymerase Chain Reaction – PCR • Denaturation at 94° C • Annealing at 54° C • Extension at 72° C

  12. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion

  13. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion

  14. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion

  15. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion

  16. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion

  17. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion

  18. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion

  19. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion

  20. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion

  21. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion

  22. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion

  23. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion

  24. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion

  25. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion

  26. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion

  27. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion

  28. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion Gel electrophoresis – running a gel • DNA is negatively charged • When placed in a tray containing positive and negative electrodes, • It moves through the gel from – to + • The DNA is dyed so that it is visible • Smaller pieces move faster (farther) • A “ladder” is formed from DNA strands of known sizes and is used for calibration

  29. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion

  30. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion

  31. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion

  32. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion Molecular Computation of Solutions to Combinatorial Problems (1994) Adleman’s seven city Hamiltonian Path problem. The graph was designed to have only one possible solution.

  33. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion Adleman’s Algorithm: Step 1: Generate random paths through the graph Step 2: Keep only those paths which begin with v in and end with v out. Step 3: If the graph has n vertices, then keep only those paths which enter exactly n vertices. Step 4: Keep only those paths which enter all of the vertices of the graph at least once. Step 5: If any paths remain, say ``YES'', otherwise say ``No''.

  34. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion Vertices (cities) are represented as 20-mer strands as follows: O2 = 5’ TATCGGATCGGTATATCCGA 3’ O3 = 5’ GCTATTCGAGCTTAAAGCTA 3’ O4 = 5’ GGCTAGGTACCAGCATGCTT 3’

  35. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion Vertices (cities) are represented as 20-mer strands as follows: O2 = 5’ TATCGGATCGGTATATCCGA 3’ O3 = 5’ GCTATTCGAGCTTAAAGCTA 3’ O4 = 5’ GGCTAGGTACCAGCATGCTT 3’ How many bits to encode 7 cities?

  36. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion Vertices (cities) are represented as 20-mer strands as follows: O2 = 5’ TATCGGATCGGTATATCCGA 3’ O3 = 5’ GCTATTCGAGCTTAAAGCTA 3’ O4 = 5’ GGCTAGGTACCAGCATGCTT 3’ How many bits to encode 7 cities? How long a DNA strand is required?

  37. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion Vertices (cities) are represented as 20-mer strands as follows: O2 = 5’ TATCGGATCGGTATATCCGA 3’ O3 = 5’ GCTATTCGAGCTTAAAGCTA 3’ O4 = 5’ GGCTAGGTACCAGCATGCTT 3’ How many bits to encode 7 cities? How long a DNA strand is required? Why 20-mer strands?

  38. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion Their complements are: ~O2 = 3’ ATAGCCTAGCCATATAGGCT 5’ ~O3 = 3’ CGATAAGCTCGAATTTCGAT 5’ ~O4 = 3’ CCGATCCATGGTCGTACGAA 5’

  39. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion The directed edges as: O2→3 = 5’ GTATATCCGAGCTATTCGAG 3’ O3→2 = 5’ CTTAAAGCTATATCGGATCG 3’ O3→4 = 5’ CTTAAAGCTAGGCTAGGTAC 3’

  40. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion

  41. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion “Unfortunately, although I held the solution in my hand, I also held about 100 trillion molecules that encoded paths that were not Hamiltonian. These had to be eliminated.” [Adleman, 1998]

  42. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion Adleman’s Algorithm: Step 1: Generate random paths through the graph Step 2: Keep only those paths which begin with v in and end with v out. Step 3: If the graph has n vertices, then keep only those paths which enter exactly n vertices. Step 4: Keep only those paths which enter all of the vertices of the graph at least once. Step 5: If any paths remain, say ``YES'', otherwise say ``No''.

  43. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion Step 2 of the algorithm requires that only the DNA strands that begin at the first vertex and end at the last vertex be kept. This requirement was achieved using PCR. By adding the correct primers to the solution, the DNA strands beginning at city0 and ending at city6 can be made to multiply exponentially. After a sufficient amount of time, they will make up the vast majority of the solution.

  44. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion The PCR works as follows: A primer for the start city and another for the terminal city are added to the solution containing the result of the computation. DNA strands containing both the starting city and the terminal city are multiplied exponentially. Strands containing one of the two cities are multiplied linearly but none of the other strands are multiplied at all.

  45. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion

  46. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion Adleman’s Algorithm: Step 1: Generate random paths through the graph Step 2: Keep only those paths which begin with v in and end with v out. Step 3: If the graph has n vertices, then keep only those paths which enter exactly n vertices. Step 4: Keep only those paths which enter all of the vertices of the graph at least once. Step 5: If any paths remain, say ``YES'', otherwise say ``No''.

  47. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion Step 3 requires the length of the strands to be measured, to determine whether or not they contain all of the cities. Remember that not all strands beginning at (O0) and ending at (O6) need contain all the remaining cities. Measuring the length of the strands is achieved using gel electrophoresis. The DNA corresponding to the required length (140-mer = 7 vertices x 20-mer/ vertex), as measured by the gel, was cut out of the gel, PCR amplified and purified.

  48. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion

  49. DNA Computing Adleman’s Algorithm: Step 1: Generate random paths through the graph Step 2: Keep only those paths which begin with v in and end with v out. Step 3: If the graph has n vertices, then keep only those paths which enter exactly n vertices. Step 4: Keep only those paths which enter all of the vertices of the graph at least once. Step 5: If any paths remain, say ``YES'', otherwise say ``No''. Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion

  50. DNA Computing Introduction Molecular Computing Adleman 1994 Conclusion Academic Programs Discussion To implement Step 4, generate single stranded DNA from the resulting product of Step 3. The single stranded DNA is used in a process called affinity separation.

More Related