1 / 32

Exploring the Rapid Evolution of Bacteria and Their Impact on Human Health

Discover the vast world of bacteria, their dangerous potential, and rapid evolution. Learn about bacterial genomes and replication processes, including mutation and recombination. Explore the significance of bacterial sex and lineage. Delve into the complex assignment patterns of Salmonella enterica in different animals. Uncover the profound implications of bacterial diversity on human and animal health.

zarifa
Télécharger la présentation

Exploring the Rapid Evolution of Bacteria and Their Impact on Human Health

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Bacteria are extremely numerous 1030 vs 1010 bacteria humans 1014 vs 1013 bacterial cells in human cells in a human body a human body

  2. Bacteria can be extremely dangerous • In the 19th Century 1 in 7 deaths was caused by a single bacterial lineage (Mycobacterium tuberculosis) • TB still causes 1.7 million deaths annually

  3. Bacteria evolve extremly rapidly

  4. Bacterial genomes are small: 4,000,000 bp vs 2 * 3,000,000,000 bp typical bacteria human

  5. Bacterial replication

  6. Bacterial sex

  7. ACTTGCTTTCGACCCTAGGATTTTACTTCTTT Point mutation ACTTGCTTTCGACCCTTGGATTTTACTTCTTT ACTTGCTTTCGACCCTAGGATTTTACTTCTTT + GACCTTAGCATTAT Homologous recombination ACTTGCTTTCGACCTTAGCATTATACTTCTTT

  8. Branch swapping algorithm father daughter Node that will be transplanted

  9. Salmonella enterica

  10. Salmonella enterica

  11. ? ?

  12. Assignment to sheep vs chicken vs cow.

  13. ~21 complex 518

  14. 369 369 369 369 274 274 274 274 621 621 621 621 519 519 519 518 262 262 262 262 275 275 275 275 642 642 642 642 742 742 742 641 641 641 300 300 300 487 487 487 615 615 615 635 635 268 21 21 21 43 43 43 8 8 423 423 423 368 368 368 719 719 719 722 722 722 341 341 341 341 44 44 44 44 748 748 748 752 752 752 712 712 712 302 302 302 345 345 345 345 409 409 409 409 Chicken Ruminant

More Related