1 / 40

Comprehensive Guide to Gene Sequence Analysis: Tools and Techniques

This document outlines essential bioinformatics techniques for genomic analysis, including gene sequence searching, cutting site identification for specific sequences, sequence alignment, and conserved domain searches. It also covers Open Reading Frame (ORF) finding and highlights useful resources such as BLAST and restriction mapping tools. Researchers can benefit from detailed analysis protocols and links to computational tools for examining structural properties of proteins and nucleic acids, facilitating advancements in genomics and proteomics.

zora
Télécharger la présentation

Comprehensive Guide to Gene Sequence Analysis: Tools and Techniques

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Bioinformatics On Genomics Hsueh-Fen Yuki Juan April 28, 2003

  2. Outline • Gene Sequence Searching • Cutting Site for a Specific Sequence • Sequence Alignment • Search for Conserved Domains • ORF Finding

  3. Gene Sequence Searching • Cutting Site for a Specific Sequence • Sequence Alignment • Search for Conserved Domains • ORF Finding

  4. Gene Sequence Searching Accession Number Gene Sequence

  5. http://www.ncbi.nlm.nih.gov/UniGene/ AA046701 AA069414 AA070289 AA446013 AA425102

  6. GGGGGGGGGAAGCTGAGCGCTGAGACCAAGGGCTAAAGCTGGGAGACTGAAAAAATGCAG ACCGCCGGGGCATTATTCATTTCTCCAGCTCTGATCCGCTGTTGTACCAGGGGTCTAATC AGGCCTGTGTCTGCCTCCTTCTTGAATAGCCCAGTGAATTCATCTAAACAGCCTTCCTAC AGCAACTTCCCACTCCAGGTGGCCAGACGGGAGTTCCAGACCAGTGTTGTCTCCCGGGAC ATTGACACAGCAGCCAAGTTTATTGGTGCTGGGGCAGCCACAGTTGGTGTGGCTGGTTCA GGGGCTGGCATTGGAACCGTGTTTGGCAGCTTGATCATTGGCTATGCCAGGAACCCGTCT CTCAAGCAGCAGCTCTTCTCCTATGCCATTCTTGGCTTTGCCCTGTCTGAGGCCATGGGG CTTTTCTGTTTGATGGTCGCCTTCCTCATCCTCTTCGCCATGTGAGGCTCCATGGGGGGT CACCGGCCTGTTGCTACTGCAACTCCACACCATTCTTGGTGCTGGGGTGTGTTAAGCTTT ACCATTAAACACAACGTTTCTCTAAAAAAAAAAAAAAAAAAAAC

  7. Gene Sequence Searching • Cutting Site for a Specific Sequence • Sequence Alignment • Search for Conserved Domains • ORF Finding

  8. Cutting Site for a Specific Sequence Sequence • Cut by Restriction Enzymes • RestrictionMapper • REBASE • NEBcutter • DARWIN

  9. RestrictionMapper http://www.restrictionmapper.org

  10. REBASE Rebase.neb.com/ rebase.html

  11. DARWIN http://darwin.bio.geneseo.edu/~yin/ WebGene/RE.html

  12. Gene Sequence Searching • Cutting Site for a Specific Sequence • Sequence Alignment • Search for Conserved Domains • ORF Finding • Primary Structure Analysis: Amino acid composition, pI and MW • Protein Sequence Searching • Proteomics Tools

  13. Sequence Alignment InputQuery DNA Sequence Amino Acid Sequence blastx tblastx blastn Blastp tblastn Compares Against Translated Nucleotide Sequence Database Compares Against protein Sequence Database Compares Against protein Sequence Database Compares Against Translated Nucleotide Sequence Database Compares Against Nucleotide Sequence Database

  14. http://www.ncbi.nlm.nih.gov/ BLAST

  15. Copy Sequence

  16. Pairwise BLAST

  17. Gene Sequence Searching • Cutting Site for a Specific Sequence • Sequence Alignment • Search for Conserved Domains • ORF Finding

  18. Search for Conserved Domains

  19. Gene Sequence Searching • Cutting Site for a Specific Sequence • Sequence Alignment • Search for Conserved Domains • ORF Finding

  20. ORF Finder (Open Reading Frame Finder) http://www.ncbi.nlm.nih.gov/gorf/

  21. Useful Bio-Websites euGene http://iubio.bio.indiana.edu:8089/ Proteome Analysis @EBI http://www.ebi.ac.uk/proteome/ GeneCards http://genecards.ym.edu.tw/

More Related