1 / 11

ATP Synthase: Subunit Gamma

ATP Synthase: Subunit Gamma. Lauren Ivey. Resveratrol binds to gamma, alpha, beta Hydrolysis and synthesis Hydrophobic pocket between beta and gamma subunit Gamma Because beta most likely more highly conserved Alpha, beta in larger scale project. ATP synthase animation. Grape to blueberry.

fauna
Télécharger la présentation

ATP Synthase: Subunit Gamma

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. ATP Synthase: Subunit Gamma Lauren Ivey

  2. Resveratrol binds to gamma, alpha, beta • Hydrolysis and synthesis • Hydrophobic pocket between beta and gamma subunit • Gamma • Because beta most likely more highly conserved • Alpha, beta in larger scale project

  3. ATP synthase animation

  4. Grape to blueberry

  5. Blueberry hits from grape • TAGTCCGAAACCGGATGAAGAGTGTGAAGAATATCCAGAAAATTACTAAGGCCATGAAAA • TGGTTGCAGCATCTAAGCTGCGAGCTATTCAAGTTAGGGCTGAGAATTCCCGTGGCCTAT • GGCAGCCATTTACTGCACTTCTTGG • GTTCTGTTCAATGCTGTCTTGGAGAATGCTACCAGTGAGCAAGGAGCAAGGATGTCTGCC • ATGGATAGCTCCAGCAGAAATGCTGGAGACATGCTTGACCGCCTCACGCTTACTTATAAC

  6. Blueberry to bovine

  7. Grape to Bovine

  8. Blueberry to human

  9. Next Steps • Amino acid sequences • Bovine, grape, blueberry • Beta and alpha • Interactions with resveratrol structure • Hypothesis: No hydrophobic pocket and resveratrol does not bind to ATP synthase in blueberry and grape

  10. Why do we care? • cardiovascular disease and neurological disorders • cardiac ischemia- • Prevents hydrolysis of ATP • apoptosis • Selective induction • Normal cells change binding sites Gledhill, J.R et al. Mechanism of inhibition of bovine F1-ATPase by resveratrol and related polyphenols. PNAS. 2007; 104(34): 13632-13637.

More Related