1 / 25

Enter the following Micro-RNA sequence into the box Run MFold and look at the results

Using MFold to predict RNA secondary structure http://mfold.rna.albany.edu/?q=mfold/RNA-Folding-Form. Enter the following Micro-RNA sequence into the box Run MFold and look at the results.

feo
Télécharger la présentation

Enter the following Micro-RNA sequence into the box Run MFold and look at the results

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Using MFold to predict RNA secondary structure http://mfold.rna.albany.edu/?q=mfold/RNA-Folding-Form Enter the following Micro-RNA sequence into the box Run MFold and look at the results GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC

  2. Constraint information • Force bases 30-35 to be single stranded • Is the result different?

  3. PSIPRED (Protein Structure Prediction Server) Secondary Structure Prediction http://bioinf.cs.ucl.ac.uk/psipred/ 1. Use the protein NP_360043. 2. Paste the sequence without the header line. 3. Enter your UH email address. 4. Click the Predict button. 5. View the results.

  4. Helix Coil Beta Strand

  5. Beta Strand Helix Coil

  6. 3-D structures

  7. Retrieving and displaying a 3-D structure from PDB http://www.rcsb.org/pdb/ • Enter the protein's name and click search • View the protein with KiNG viewer • Examine the information and links to • other databases

  8. Protein visualization with FirstGlance in Jmolhttp://molvis.sdsc.edu/fgij/

  9. Alpha Helices Beta strands Random coils Secondary Structure

  10. MMDB • NCBI's structure database is called MMDB (Molecular Modeling DataBase), and it is a subset of experimentally derived three-dimensional structures obtained from the Protein Data Bank (PDB) (excluding theoretical predictions) • http://www.ncbi.nlm.nih.gov/Structure/MMDB/mmdb.shtml

  11. VAST • NCBI creates and maintains a database of structure alignments, called VAST, for all pairs of proteins from MMDB whose structures have some similar core regions. They are called “Structural neighbors”. • http://www.ncbi.nlm.nih.gov/Structure/VAST/vast.shtml

  12. Example • Type "1D5R" in the query box and hit "Get." This brings up the MMDB summary page.

  13. The graphic is saying that the protein is composed of a single chain (A) that NCBI has parsed into two domains: the N-terminal domain 1, and C-terminal 2. Clicking on the top bar marked "Chain A" will bring up VAST neighbors based on the whole chain, while clicking on the colored regions marked "1" or "2" will show neighbors of these individual domains.

  14. Click on the “1” domain to get proteins that consists of a similar structure like the PTPc domain

  15. Lets view the "3D Alignment” of 1D5R:A with 2BZL:A using the CE tool http://cl.sdsc.edu/ce.html Crystal Structure Of The Human Protein Tyrosine Phosphatase N14 At 1.65 A Resolution

  16. The two sequences have a 20.7% sequence similarity. The root mean square deviation (RMSD) in terms of structural distance is 2.47. Now lets compare hemoglobin A (4HHB:A) and B (4HHB:B)?

  17. Hemoglobin A and B have a sequence similarity of 40.3 % and a root mean square deviation of 1.49.

  18. Tertiary structure prediction • From ExPASy http://www.expasy.org/tools/, you can find links to many prediction servers:

  19. Tertiary structure prediction • For example the HMMSTR/Rosetta server predicts protein structure from sequence (Ab initio).

  20. Protein 3D structure predictionHMMSTR/Rosetta Web Server It takes a very long time, you'll get the answer by e-mail.

More Related