1 / 24

Longterm Estuary Assessment Group

LaFleur Lab. Longterm Estuary Assessment Group. Developing biomarkers of reproductive health in fish and amphibians of the Barataria-Terrebonne Estuary

fredrica
Télécharger la présentation

Longterm Estuary Assessment Group

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. LaFleur Lab Longterm Estuary Assessment Group Developing biomarkers of reproductive health in fish and amphibians of the Barataria-Terrebonne Estuary LaFleur, Pitre, Lasseigne, and Nelson nicholls state university NOAA '07 Eco Impacts of Hypoxia

  2. The Barataria-Terrebonne Estuary is impaired • lack of flow • saltwater intrusion • land-loss Graphic from Restore or Retreat: www.restoreorretreat.org Having been isolated from freshwater inputs it is lacks flushing, sheet flow, and an ecological flood pulse NOAA '07 Eco Impacts of Hypoxia

  3. USACE Butte La Rose Gage 03120 ('59-'04) The 46-year mean stage of the Atchafalaya still reflects an ecological flood pulse

  4. from Estay and Fontenot (thesis) In the Upper Barataria basin, Hypoxia can occur But it is usually associated with Rainwater events, rather than flood stage

  5. Our estuary is slated for largescale hydrologic modifications: Graphic from Restore or Retreat: www.restoreorretreat.org one project proposes diverting 300,000 cfs water into the BTE; up to 6 sq mi / year; at a cost of $25 / cubic yard NOAA '07 Eco Impacts of Hypoxia

  6. Pipeline Slurry System A more recently presented scenario would utilize a sediment pipeline slurry system to build land even quicker: up to15 sq mi / year; at a cost of $4 /cubic yard NOAA '07 Eco Impacts of Hypoxia

  7. MY OBJECTIVES • In preparation for hydrologic changes due to further deterioration or restoration activities in our estuary, my lab has begun a survey • to monitor behavioral indicators of reproduction in amphibians of the estuary • to monitor anatomical indicators of reproduction in amphibians of the estuary • to monitor molecular indicators of reproduction in amphibians of the estuary NOAA '07 Eco Impacts of Hypoxia

  8. 2 5 1 3 4 Site 1 Choctaw swamp; Site 2 Chacahoula swamp Site 3 Nicholls’ Environmental Ag Facility Site 4 Falgout Canal fw / brackish marsh Site 5 fish only at Isle Dernieres Barrier Islands NOAA '07 Eco Impacts of Hypoxia

  9. Reproductive behavior is being surveyed in three LAMP survey routes: spanning Lafourche and Terrebonne Parishes NOAA '07 Eco Impacts of Hypoxia

  10. In 2007, Spring Peepers reached peak calling in Feb Northern Cricket frogs peaked in Jan, but are still calling temp calls temp calls

  11. Confirmed Hyla avivoca Choctaw Swamp, Lafourche Parish

  12. Proposed Expansion of Geographic Range to the BTES, south of the Mississippi River Conant and Collins.1991

  13. liver ovary Selected species are collected, dissected, and anatomical indicators are examined NOAA '07 Eco Impacts of Hypoxia

  14. Amphibian Survey Matrix

  15. Approach todesigning biomarkers for estrogen-induction • Injection of estradiol into males • Isolation of liver RNA • RT-PCR for Vtg, Chg from homogenates using degenerate and heterologous primers NOAA '07 Eco Impacts of Hypoxia

  16. vitellogenins and choriogenins vitelline envelope precursor to the chorion Estrogen induced Liver synthesis of teleost follicle choriogenins and vitellogenins cells HETEROSYNTHETIC ORIGIN OF yolk of oocyte TELEOSTEAN EGG PROTEINS micropyle NOAA '07 Eco Impacts of Hypoxia

  17. Choriogenin Primers Row 78 TTCAGGTTCCAGAATTCTGAC Row 81 CATTGGTTCATATCGCTGTCT Vitellogenin Primers Row 8 CGATATTGACATGTTTCCAA Row 24 TACCAGCTTGGTTTCTACCT Choriogenin and Vitellogenin primers derived from F. heteroclitus, the mummichog. Row 78 and Row 81 produce a 450 bp product while Row 8 and Row 24 produce a 729 bp product NOAA '07 Eco Impacts of Hypoxia

  18. 450 bp choriogenin F.g. liver F.c. liver G.a. liver A.t. ovary a b c d Choriogenin cDNAs indicating normal female reproductive activity. NOAA '07 Eco Impacts of Hypoxia

  19. 729 bp (Estrogen-injected males) vitellogenin a b c a= Fundulus grandis liver, b= Fundulus chrysotus liver, c= Amphiuma tridactylum liver NOAA '07 Eco Impacts of Hypoxia

  20. 729 bp (Non-injected males) vitellogenin a b c Three wild-caught males showing the presence of female specific RNA a= Bufo valliceps liver, b= Amphiuma tridactylum liver c= Gambusia affinis NOAA '07 Eco Impacts of Hypoxia

  21. Fish and Amphibians Through collaborations between the labs of LaFleur, Ferrara and Fontenot we have established overlapping projects of the estuarine fauna, including monitoring of finfish, larval fish, and amphibians. NOAA '07 Eco Impacts of Hypoxia

  22. LaFleur Lab Summary • Documented reproductive behavior through calls of 12 local Anuran species. • Established herpetology collection. • Tracking reproductive seasons by measuring GSI on 4 Anurans, 1 Salamander, 3 fish. • Molecular biomarkers were amplified using RT-PCR on 3 anurans, 1 Salamander, 3 fish. • Poised to implement reproductive survey to include water quality and expanded sampling regime. • Proposed range extension for Hyla avivoca to include wetlands of the BTES.

  23. Post Katrina Directions Amphibian and Fish reproduction will be utilized as a longterm assessment tool for environmental health of the estuary Nicholls has been awarded a grant for restoration planting by NOAA Nicholls has signed an MOU with NRCS for restoration plant propagation at Nicholls Farm LaFleur, Boopathy, and Zou are committed to longterm monitoring programs that will offer consistency over time NOAA '07 Eco Impacts of Hypoxia

More Related