'Minor allele' diaporamas de présentation

Genetics & Epigenetics in IPF

459 views • 45 slides

Genome Biology & Applied Bioinformatics Mehmet Tevfik DORAK, MD PhD

Genome Biology & Applied Bioinformatics Mehmet Tevfik DORAK, MD PhD. Schedule. Schedule. Single Nucleotide Polymorphisms. Any nucleotide (A, C, G, T) > Another nucleotide C > T major allele > minor allele common allele > rare allele wildtype allele > variant allele

235 views • 22 slides

genetic variation is meaningful only in the context of a population

ccagtcagag A tgtgcacatggcttagttttcataca G agcctgggctgggggtggggtg ccagtcagag A tgtgcacatggcttagttttcatacacagcctgggctgggggtggggtg ccagtcagagttgtgcacatggcttagttttcatacacagcctgggctgggggtggggtg ccagtcagag A tgtgcacatggcttagttttcatacacagcctgggctgggggtggggtg

223 views • 15 slides

2009-09-10

InCoB 2009. MapNext: a software tool for spliced and unspliced alignments and SNP detection of short sequence reads. Hua Bao Sun Yat-sen University, Guangzhou, China Evolution.sysu.edu.cn. 2009-09-10. Next-generation sequencing. High-throughput (tens of millions reads per lane)

293 views • 14 slides

2009-09-10

InCoB 2009. MapNext: a software tool for spliced and unspliced alignments and SNP detection of short sequence reads. Hua Bao Sun Yat-sen University, Guangzhou, China Evolution.sysu.edu.cn. 2009-09-10. Next-generation sequencing. High-throughput (tens of millions reads per lane)

213 views • 14 slides

Genetic determinants of dabigatran plasma levels and their relation to bleeding

Genetic determinants of dabigatran plasma levels and their relation to bleeding. Guillaume Pare MD.

146 views • 14 slides

Introduction PACG has long been thought to have a significant genetic basis. 1,2

Program Number: 6221. Genetic Susceptibility Variations and Visual Field Progression in Singaporean Chinese Patients with Primary Angle Closure Glaucoma.

124 views • 1 slides