'Reference genome' diaporamas de présentation

LPHIG Bioinformatics of SFS Genomics Center Program Projects

LPHIG Bioinformatics of SFS Genomics Center Program Projects. Project leader: Chun-Yuan Huang 1 Members : Charles Joseph Murphy 1 , Aurash Mohaimani 2 PIs: Peter J. Tonellato 1,2,3 , Rebecca Klaper 4 1. Zilber School of Public Health, University of Wisconsin at Milwaukee, Milwaukee, WI

1k views • 87 slides

LPHIG Bioinformatics of SFS Genomics Center Program Projects

LPHIG Bioinformatics of SFS Genomics Center Program Projects. Project leader: Chun-Yuan Huang 1 Members : Charles Joseph Murphy 1 , Aurash Mohaimani 2 PIs: Peter J. Tonellato 1,2,3 , Rebecca Klaper 4 1. Zilber School of Public Health, University of Wisconsin at Milwaukee, Milwaukee, WI

956 views • 82 slides

ChIP Sequencing BMI/IBGP 730

ChIP Sequencing BMI/IBGP 730. Victor Jin, Ph.D. (Slides from Dr. H. Gulcin Ozer) Department of Biomedical Informatics. What is ChIP-Sequencing?. ChIP-Sequencing is a new frontier technology to analyze protein interactions with DNA. ChIP-Seq

681 views • 46 slides

Next Generation Sequencing

Next Generation Sequencing. Sequencing techniques. ChIP-seq MBD-seq (MIRA-seq) BS-seq RNA-seq miRNA-seq. ChIP-seq. ChIP-Seq is a new frontier technology to analyze in vivo protein-DNA interactions. ChIP-Seq

834 views • 37 slides

Personalized Genomics Overview

Personalized Genomics Overview. Genetic testing status and prospects Types of human variation Detection of human genomic variation GWAS Nextgen sequencing Challenges Ethical questions. Types of Genetic Testing. Scientific Research Between species: phylogenetics Within human species

538 views • 35 slides

Functional Genomics with Next-Generation Sequencing

Functional Genomics with Next-Generation Sequencing . Jen Taylor Bioinformatics Team CSIRO Plant Industry. Capacity and Resolution. Next generation sequencing Increasing capacity leads to increased resolution. Eric Lander, Broad Institute. How a Genome Works?. Parts Description

446 views • 32 slides

Multiple alignment method

Multiple alignment method. Find homologous sequences Place the sequences in a relevant format (usually FASTA), and edit to similar length. Example

585 views • 31 slides

A01-P

Title: The Brassica rapa FLC homolog BrFLC2 is a key regulator of flowering time, identified through transcriptional co-expression networks.

464 views • 30 slides

Finding genes de novo with RNA- seq

439 views • 22 slides

341 views • 22 slides

High Throughput Sequencing

High Throughput Sequencing. Xiaole Shirley Liu STAT115, STAT215, BIO298, BIST520. First Generation. Sanger Sequencing: sequencing and detection 2 different steps: 384 * 1kb / 3 hours. Second Generation. Massively parallel sequencing by synthesis

859 views • 22 slides

Genome Assembly Stewardship (Ames)

Genome Assembly Stewardship (Ames). Objective 1: Support stewardship of maize genome sequences and forthcoming diverse maize sequences.

341 views • 21 slides

A cloud computing-based framework facilitating high throughput sequencing analyses

371 views • 19 slides

283 views • 19 slides

How do we represent the position specific preference ?

G: 5 -> 71% S: 1 -> 14 % C: 1 -> 14 %. Basic concept of motif identification 2. How do we represent the position specific preference ?. BID_MOUSE I A R H L A Q I G D E M BAD_MOUSE Y G R E L R R M S D E F BAK_MOUSE V G R Q L A L I G D D I

327 views • 19 slides

Global Variation in Copy Number in the Human Genome

Presentation by Chris Wescott and Angelica Stamegna. Global Variation in Copy Number in the Human Genome. Purpose. We, as humans, are 99.5% similar in our genetic make up 1 in 1,000 bp different Used the dissimilarities across populations, to come up with a whole genome CNV map

601 views • 17 slides

CS267 Class Project Suggestions

CS267 Class Project Suggestions. Spring 2014. Class project suggestions. Many kinds of projects Reflects broad scope of field and of students, from many departments Need to do one or more of design / program / measure some parallel application / kernel / software tool / hardware

281 views • 16 slides

genetic variation is meaningful only in the context of a population

ccagtcagag A tgtgcacatggcttagttttcataca G agcctgggctgggggtggggtg ccagtcagag A tgtgcacatggcttagttttcatacacagcctgggctgggggtggggtg ccagtcagagttgtgcacatggcttagttttcatacacagcctgggctgggggtggggtg ccagtcagag A tgtgcacatggcttagttttcatacacagcctgggctgggggtggggtg

223 views • 15 slides

Quality filtering using ConvertGerald Convert reads to fasta format

Quality filtering using ConvertGerald Convert reads to fasta format. Extract coordinates for exon, transcript, gene, non-coding regions. Align reads to the genome (with Eland software ) allowing up to10 perfect alignments up to 5 alignments with 1-mismatch

99 views • 2 slides

Diversity Data at MaizeGDB

Diversity Data at MaizeGDB. Ethalinda KS Cannon 1 , Carson M. Andorf 2 , Bremen L. Braun 2 , Darwin A. Campbell 2 , Mary L. Schaeffer 3,4 , Cheng-Ting Yeh 5 , Patrick S. Schnable 5 , Carolyn J Lawrence 1,2

114 views • 1 slides