1 / 27

Recent advancements in strawberry integrated disease management in NC

Recent advancements in strawberry integrated disease management in NC. Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State University. Host resistance mechanism against Anthracnose caused by Colletotrichum acutatum. Anthracnose ripe fruit rot.

tibor
Télécharger la présentation

Recent advancements in strawberry integrated disease management in NC

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State University

  2. Host resistance mechanism against Anthracnose caused by Colletotrichumacutatum

  3. Anthracnoseripe fruit rot Lesions are more sunken under dry condition while salmon color spore mass is common under high relative humidity on less sunken lesions

  4. All parts of strawberry are susceptible to C. acutatumAnthracnose petiole rot, flower blight & green fruit rot Symptom on green fruit

  5. AFR incidence on 14 genotypes in plasticulture system, ‘07 & ‘08

  6. Invitro evaluation of anthracnose fruit rot severity

  7. Rank sum method • a, b and c are genotype ranking using lesion diameter at 8 DAI from three different experiments; • d= rank-sum (a + b +c) for each genotype; • e = deviation from the grand mean (G) of the rank-sums ([e = (d –G)/standard deviation] × 3).

  8. Invitro AFR resistance Seascape is a day-neutral (everbearing) cultivar NC C02-63 is a short-day advance breeding line

  9. Selection of genotypes possessing QI and AFR resistance

  10. Variability in overall resistance explained by true fruit resistance and resistance quiescent infection a Confidence limit

  11. Correlation of field AFR incidence with induced level of defense enzyme

  12. Detection and quantification of Colletotrichumspp from quiescent infections

  13. Development of a real time PCR protocol for QI The primer/probe set and capture probe was designed from the consensus sequence using Beacon Designer software from 45 ITS sequences of C. acutatum and C. gloeosporioides. bDMT-Difference in melting temperature of amplicons from C. acutatum and C. gloeosporioides template when reverse primer is used with different combinations of forward primers.

  14. Species discrimination by melt curve analysis gloGCTTGGTGTTGGGGCCCT ACAGCTGATGT AGGCCCTCAAAGGTAGTGGCGGACCCTCCCG acuGCTTGGTTTT GGGGCCCCACGGCCGACGTGGGCCCTT AAAGGTAGTGGCGGACCCTCCCG glo GAGCCTCCTTTGCGTAGTAACTTT ACGTCTCGCACTGGGATCCGGAGGGACTCTTGCCGT acu GAGCCTCCTTTGCGTAGTAACT -AACGTCTCGCACTGGGATCCGGAGGGACTCTTGCCGT gloAAAACC acuT AAACC Primer binding site

  15. Melt curve (HRM) analysis in Rotor gene 6000 qPCR system C. gloeosporioides C. acutatum

  16. Utilization of the tool in assessing field samples • Superior detection capacity • Superior in terms of “sensitivity, specificity and speed” • Lowest detection limit is 5 cfu/1pg

  17. AFR prediction based on foliar quiescent infection 2009 No AFR

  18. Chemical control of AFR 2008

  19. Efficacy of reduced spray schedule and premixed active ingredients ‘09 A16001EW = a premix of difenoconazole + cyprodinil (Inspire Super). A13703 = a premix of difenoconazole + azoxystrobin (Quadris Top).

  20. Precision disease management for sustainable strawberry production in the Southeast U.S/Prediction based spray program • The variable %INF is calculated from the equation: • In (%INF / [1-%INF]) = -3.70 + 0.33W – 0.069WT + 0.0050WT2 – 0.93 x 10 – 4WT3 where W = the duration of a preceding wetness interval and T= mean temperature( 0C) during the interval. • If threshold expressed by %INF is 0.15 will indicate the need for Captan spray • When threshold reaches 0.50 will indicate the need for pyraclostrobin spray

  21. Skybit weather forecast • E-WEATHER                                               FORECAST AND SUMMARY    For: NC-NEW HANOVER-CASTLE HAYNE                        Date: THU JUN  3, 2010                       <----------------- 0-48 HOUR FORECAST---------------->     DATE                          Jun  3                         Jun  4             HOUR (EDT)           8a 11a  2p  5p  8p 11p  2a  5a  8a 11a  2p  5p  8p 11p     ------------------------------------------------------------------------------  TEMP (F)              75  83  86  84  79  75  74  73  75  84  87  85  80  76     2"- SOIL TEMP (F)    77  81  84  86  85  82  78  75  76  80  84  87  86  82     REL HUM (%)          91  71  63  68  79  89  91  95  90  66  58  63  76  89     6HR PRECIP(in)      .00/    .00/    .00/    .00/    .00/    .00/    .00/        6HR PRECIP PROB(%)   19/     13/     22/     13/     16/      9/     23/        3HR EVAP (in)       .02 .06 .11 .10 .04 .00 .00 .00 .01 .07 .12 .10 .04 .02     3HR WETNESS (hrs)     2   2   0   0   0   0   1   3   3   3   0   0   0   0     WIND DIR (pt)       SSW  SW SSW SSW SSW SSW SSW  SW WSW WSW SSW   S SSW  SW     WIND SPEED (mph)      6   9  10  11   8   4   4   5   6   6   7  11   7   3     CLOUD COVER         OVC BKN BKN BKN SCT BKN BKN BKN BKN SCT SCT BKN OVC OVC     3HR RADIATION (ly)    8  88 173 149  59   1   0   0  18 126 208 166  48   0     PCT RADIATION (%)    32  56  71  70  74 100 --- ---  72  79  85  78  60   0     

  22. HOBO leaf wetness smart sensor SENSOR

  23. Determination of wetness hours

  24. Prediction based spray schedule aDisease incidence was calculated from all harvested fruits over 8 weeks bMeans in a column followed by the same letter are not significantly different by Fisher’s protected LSD test (α ≤ 0.05).

  25. Weather based Prediction Weather based Prediction ing stock Removal of senesced tissue & Sensitive Detection Tool Host Resistance Quiescently Infected – exclude from planting stock Integrated Strawberry Disease Management Weather based Prediction Weather based Prediction Reduced spray schedule Optimum fertility Calcinit-Ca(NO3)2 Weather based Prediction Weather based Prediction Infected fruits

  26. Acknowledgements • Mike Carnes and Jim Driver • NC strawberry growers association • North American Strawberry growers association • California strawberry commission • Southern region IPM center • SkyBit - ZedX, Inc SkyBit - ZedX, Inc.

More Related