Download
hgp april 2008 n.
Skip this Video
Loading SlideShow in 5 Seconds..
THE HUMAN GENOME PROJECT published ‘completed’ results 14 th April 2003. WHAT IS IT? PowerPoint Presentation
Download Presentation
THE HUMAN GENOME PROJECT published ‘completed’ results 14 th April 2003. WHAT IS IT?

THE HUMAN GENOME PROJECT published ‘completed’ results 14 th April 2003. WHAT IS IT?

157 Vues Download Presentation
Télécharger la présentation

THE HUMAN GENOME PROJECT published ‘completed’ results 14 th April 2003. WHAT IS IT?

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. hgp april 2008

  2. THE HUMAN GENOME PROJECT THE HUMAN GENOME PROJECT published ‘completed’ results 14th April 2003. WHAT IS IT? WHAT ARE THE AIMS? HOW IS IT DONE? BY WHOM? WHAT ARE THE BENEFITS? and, most importantly: WHAT ARE THE ETHICAL ISSUES WHICH THE HUMAN GENOME PROJECT HAS THROWN UP? hgp april 2008

  3. WHAT IS THE HUMAN GENOME? • The entire genetic makeup of the human cell nucleus. • Genes carry the information for making all of the proteins required by the body for growth and maintenance. • Made up of ~35,000-50,000 genes which code for functional proteins in the body. • Includes non-coding sequences located between genes, which makes up the vast majority of the DNA in the genome (~95%). hgp april 2008

  4. THE GENOME IS WHO WE ARE ON THE INSIDE! Chromosomes consist of: • DNA - molecular strings of A, C, G, & T base pairs • Genes • DNA sequences that encode proteins • less than 3% of human genome hgp april 2008

  5. THE GENOME IS OUR GENETIC BLUEPRINT Nearly every human cell contains 23 pairs of chromosomes • 1 - 22 and XY or XX XY = Male XX = Female Length of chr 1-22, X, Y together is ~3.2 billion bases (about 2 meters diploid) hgp april 2008

  6. hgp april 2008

  7. HOW DO GENES WORK? The particular order of nucleotide bases (As, Gs, Cs, and Ts) determines the amino acid composition of proteins. And it is the proteins in the body which give us almost all our characteristics. hgp april 2008

  8. WHAT IS THE HUMANGENOME PROJECT? U.S. govt. project coordinated by the Department of Energy and the National Institutes of Health, launched in 1986. Aims of the project: • Identify all of the genes in human DNA • Determine the sequence of the 3 billion chemical nucleotide bases that make up human DNA • Store this information in data bases • Develop faster, more efficient sequencing technologies • Develop tools for data analysis • Address the ethical, legal, and social issues (ELSI) that arise from the project. hgp april 2008

  9. TWO DIFFERENT GROUPS COMPETED TO PUBLISH THE HUMAN THE DNA SEQUENCE • The Human Genome Projct is a multinational consortium established by US government research agencies and funded publicly • Celera Genomics is a private company whose former CEO, J. Craig Venter, ran an independent sequencing project • Differences arose regarding who should receive the credit for this scientific milestone • Eventually the two agreed to publish together, though they continued to work apart. hgp april 2008

  10. WHOSE GENOME WAS SEQUENCED? • the first reference genome was a composite genome from several different people. • generated from 10-20 primary samples taken from numerous anonymous donors across racial and ethnic groups. hgp april 2008

  11. HOW MUCH DATA MAKE UP THE HUMAN GENOME? Imagine 5000 bases on 1 page……. CACACTTGCATGTGAGAGCTTCTAATATCTAAATTAATGTTGAATCATTATTCAGAAACAGAGAGCTAACTGTTATCCCATCCTGACTTTATTCTTTATG AGAAAAATACAGTGATTCC AAGTTACCAAGTTAGTGCTGCTTGCTTTATAAATGAAGTAATATTTTAAAAGTTGTGCATAAGTTAAAATTCAGAAATAAAACTTCATCCTAAAACTCTGTGTGTTGCTTTAAATAATC AGAGCATCTGC TACTTAATTTTTTGTGTGTGGGTGCACAATAGATGTTTAATGAGATCCTGTCATCTGTCTGCTTTTTTATTGTAAAACAGGAGGGGTTTTAATACTGGAGGAACAA CTGATGTACCTCTGAAAAGAGA AGAGATTAGTTATTAATTGAATTGAGGGTTGTCTTGTCTTAGTAGCTTTTATTCTCTAGGTACTATTTGATTATGATTGTGAAAATAGAATTTATCC CTCATTAAATGTAAAATCAACAGGAGAATAGCAAAAACTTATGAGATAGATGAACGTTGTGTGAGTGGCATGGTTTAATTTGTTTGGAAGAAGCACTTGCCCCAGAAGATACACAAT GAAATTCATGTTATTGAGTAGAGTAGTAATACAGTGTGTTCCCTTGTGAAGTTCATAACCAAGAATTTTAGTAGTGGATAGGTAGGCTGAATAACTGACTTCCTATC ATTTTCAGGTT CTGCGTTTGATTTTTTTTACATATTAATTTCTTTGATCCACATTAAGCTCAGTTATGTATTTCCATTTTATAAATGAAAAAAAATAGGCACTTGCAAATGTCAGATCACTTGCCTGTGGT CATTCGGGTAGAGATTTGTGGAGCTAAGTTGGTCTTAATCAAATGTCAAGCTTTTTTTTTTCTTATAAAATATAGGTTTTAATATGAGTTTTAAAATAAAATTAATTAGAAAAAGGCAA ATTACTCAATATATATAAGGTATTGCATTTGTAATAGGTAGGTATTTCATTTTCTAGTTATGGTGGGATATTATTCAGACTATAATTCCCAATGAAAAAACTTTAAAAAATGCTAGTGA TTGCACACTTAAAACACCTTTTAAAAAGCATTGAGAGCTTATAAAATTTTAATGAGTGATAAAACCAAATTTGAAGAGAAAAGAAGAACCCAGAGAGGTAAGGATATAACCTTACC AGTTGCAATTTGCCGATCTCTACAAATATTAATATTTATTTTGACAGTTTCAGGGTGAATGAGAAAGAAACCAAAACCCAAGACTAGCATATGTTGTCTTCTTAAGGAGCCCTCCCCT AAAAGATTGAGATGACCAAATCTTATACTCTCAGCATAAGGTGAACCAGACAGACCTAAAGCAGTGGTAGCTTGGATCCACTACTTGGGTTTGTGTGTGGCGTGACTCAGGTAATCT CAAGAATTGAACATTTTTTTAAGGTGGTCCTACTCATACACTGCCCAGGTATTAGGGAGAAGCAAATCTGAATGCTTTATAAAAATACCCTAAAGCTAAATCTTACAATATTCTCAAG AACACAGTGAA ACAAGGCAAAATAAGTTAAAATCAACAAAAACAACATGAAACATAATTAGACACACAAAGACTTCAAACATTGGAAAATACCAGAGAAAGATAATAAATAT TTTACTCTTTAAAAATTTAGTTAAAAGCTTAAACTAATTGTAGAGAAAA AACTATGTTAGTATTATATTGTAGATGAAATAAGCAAAACATTTAAAATACAAATGTGATTACTTAAAT TAAATATAATAGATAATTTACCACCAGATTAGATACCATTGAAGGAATAATTAATATACTGAAATACAGGTCAGTAGAATTTTTTTCAATTCAGCATGGAGATGTAAAAAATGAAAA TTAATGCAAAAAATAAGGGCACAAAAAGAAATGAGTAATTTTGATCAGAAATGTATTAAAATTAATAAACTGGAAATTTGACATTTAAAAAAAGCATTGTCATCCAAGTAGATGTG TCTATTAAATAGTTGTTCTCATATCCAGTAATGTAATTATTATTCCCTCTCATGCAGTTCAGATTCTGGGGTAATCTTTAGACATCAGTTTTGTCTTTTATATTATTTATTCTGTTTACTAC ATTTTATTTTGCTAATGATATTTTTAATTTCTGACATTCTGGAGTATTGCTTGTAAAAGGTATTTTTAAAAATACTTTATGGTTATTTTTGTGATTCCTATTCCTCTATGGACACCAAGGCT ATTGACATTTTCTTTGGTTTCTTCTGTTACTTCTATTTTCTTAGTGTTTATATCATTTCATAGATAGGATATTCTTTATTTTTTATTTTTATTTAAATATTTGGTGATTCTTGGTTTTCTCAGCC ATCTATTGTCAAGTGTTCTTATTAAGCATTATTATTAAATAAAGATTATTTCCTCTAATCACATGAGAATCTTTATTTCCCCCAAGTAATTGAAAATTGCAATGCCATGCTGCCATGTGG TACAGCATGGGTTTGGGCTTGCTTTCTTCTTTTTTTTTTAACTTTTATTTTAGGTTTGGGAGTACCTGTGAAAGTTTGTTATATAGGTAAACTCGTGTCACCAGGGTTTGTTGTACAGATCA TTTTGTCACCTAGGTACCAAGTACTCAACAATTATTTTTCCTGCTCCTCTGTCTCCTGTCACCCTCCACTCTCAAGTAGACTCCGGTGTCTGCTGTTCCATTCTTTGTGTCCATGTGTTCTC ATAATTTAGTTCCCCACTTGTAAGTGAGAACATGCAGTATTTTCTAGTATTTGGTTTTTTGTTCCTGTGTTAATTTGCCCAGTATAATAGCCTCCAGCTCCATCCATGTTACTGCAAAGAA CATGATCTCATTCTTTTTTATAGCTCCATGGTGTCTATATACCACATTTTCTTTATCTAAACTCTTATTGATGAGCATTGAGGTGGATTCTATGTCTTTGCTATTGTGCATATTGCTGCAAG AACATTTGTGTGCATGTGTCTTTATGGTAGAATGATATATTTTCTTCTGGGTATATATGCAGTAATGCGATTGCTGGTTGGAATGGTAGTTCTGCTTTTATCTCTTTGAGGAATTGCCATG CTGCTTTCCACAATAGTTGAACTAACTTACACTCCCACTAACAGTGTGTAAGTGTTTCCTTTTCTCCACAACCTGCCAGCATCTGTTATTTTTTGACATTTTAATAGTAGCCATTTTAACT GGTATGAAATTATATTTCATTGTGGTTTTAATTTGCATTTCTCTAATGATCAGTGATATTGAGTTTGTTTTTTTTCACATGCTTGTTGGCTGCATGTATGTCTTCTTTTAAAAAGTGTCTGTT CATGTACTTTGCCCACATTTTAATGGGGTTGTTTTTCTCTTGTAAATTTGTTTAAATTCCTTATAGGTGCTGGATTTTAGACATTTGTCAGACGCATAGTTTGCAAATAGTTTCTCCCATTC TGTAGGTTGTCTGTTTATTTTGTTAATAGTTTCTTTTGCTATGCAGAAGCTCTTAATAAGTTTAATGAGATCCTGATATGTTAGGCTTTGTGTCCCCACCCAAATCTCATCTTGAATTATA TCTCCATAATCACCACATGGAGAGACCAGGTGGAGGTAATTGAATCTGGGGGTGGTTTCACCCATGCTGTTCTTGTGATAGTGAATGAGTTCTCACGAGATCTAATGGTTTTATGAGG GGCTCTTCCCAGCTTTGCCTGGTACTTCTCCTTCCTGCCGCTTTGTGAAAAAGGTGCATTGCGTCCCTTTCACCTTCTTCTATAATTGTAAGTTTCCTGAGGCCTTCCCAGCCATGCTGAA CTTCAAGTCAATTAAACCTTTTTCTTTATAAATTACTCAGTCTCTGGTGGTTCTTTATAGCAGTGTGAAAATGGACTAATGAAGTTCCCATTTATGAATTTTTGCTTTTGTTGCAATTGCTT TTGACATCTTAGTCATGAAATCCTTGCCTGTTCTAAGTACAGGACGGTATTGCCTAGGTTGTCTTCCAGGGTTTTTCTAATTTTGTGTTTTGCATTTAAGTGTTTAATCCATCTTGAGTTGA TTTTTGTATATTGTGTAAGGAAGGGGTCCAGTTTCAATCTTTTGCATATGGCTAGTTAGTTATCCCAGTACCATTTATTGAAAAGACAGTCTTTTCCCCATCGCTCGTTTTTGTCAGTTTT ATTGATGATCAGATAATCATAGCTGTGTGGCTTTATTTCTGGGTTCTTTATTCTGTTCTATTGGTTTATGTCCCTGTTTTTGTGCCAGTACCATGCTGTTTTGGTTAACATAGCCCTGTAGT ATAGTTTGAGGTCAGATAGCCTGATGCTTCCAGCTTTGTTCTTTTTCTTAAGATTGCCTTGGCTATTTGGCCTCTTTTTTGGTTCCACATGAATTTTAAAACAGTTGTTTCTAGTTTTTGAA GAATGTCATTGGTAGTTTGATAGAAATAGCATTTAATCTGTAAATTGATTTGTGCAGTATGGCCTTTTAATGATATTGATTCTTCCTATCCATGAGCATGATATGTTTTCCATTTTGTTTG TATCCTCTCTGATTTCTTTGTGCAGTGTTTTGTAATTCTCAT TGTAGAGATTTTTCACCTCCCTGGTTAGTTGTATTTTACCCTAGATATTT TATTCTTTTTGTGAAAATTGTGAATGGGAT TGCCTTCCTGATTTGACTGC CAGCTTGGTTACTGTTGGTTTATAGAAATGCTAGTGATTTTTGTACATTG ATTTTCTTTCTAAAACTTTGCTGAAGTTTTTTTTATTAGCAGAAGGAGCT TTGGGGCTGAGACTATGGGGTTTTCTAGATATAGAATCATGTCAGCTTCAAATAGGGATAATTTTACTTCCTCTCTTCCTATTTGGATGCCCTTTATTTCTTTCTCTTGCCTGATTACTCTG GCTGGGATTTCCTATGTTGAATAGGAGT CATGAGAGAGGGCATCAAATCTACACATATCAAATACTAACCTTGAATGTCTAGATATTT TATTCTTTTTGTGAAAATTGTGAATGGGAT hgp april 2008

  12. HOW MUCH DATA MAKE UP THE HUMAN GENOME? • 3 pallets with 40 boxes per pallet x 5000 pages per box x 5000 bases per page = 3,000,000,000 bases! • To get accurate sequencing requires 6 time multiplication • Now: Tear up 18 pallets and reassemble them, three bases at a time! hgp april 2008

  13. THE BEGINNING OF THE PROJECT Most the first 10 years of the project were spent improving the technology to sequence and analyze DNA. Scientists all around the world worked to make detailed maps of our chromosomes and sequence model organisms, like worm, fruit fly, and mouse. hgp april 2008

  14. HOW IS IT ACCOMPLISHED? • The DNA sequence is so long that no technology can read it all at once, so it is broken into pieces. There were millions of clones (small sequence fragments). The assembly process included finding where the pieces overlapped in order to put the draft together. 3,200,000 piece puzzle anyone? hgp april 2008

  15. What do genes do anyway? • We only have ~27,000 genes, so that means that each gene has to do a lot. • Genes make proteins that make up nearly all we are (muscles, hair, eyes). • Almost everything that happens in our bodies happens because of proteins (walking, digestion, fighting disease). or or hgp april 2008

  16. GENES ARE IMPORTANT By selecting different pieces of a gene, your body can make many kinds of proteins. If a gene is “expressed” that means it is turned on and it will make proteins. hgp april 2008

  17. WHAT WE’VE LEARNED FROM OUR GENOME SO FAR… • There are a relatively small number of human genes, less than 30,000, but they have a complex architecture that we are only beginning to understand and appreciate. • We know where 85% of genes are in the sequence • We don’t know where the other 15% are because we haven’t seen them “on” • We only know what about 20% of our genes do so far. So it is relatively easy to locate genes in the genome, but it is hard to figure out what they do. hgp april 2008

  18. BENEFITS of the HGP • MEDICINE • Improvements in diagnostic and therapeutic applications • Pharmacogenomics – “personal”drugs • Organ replacement • Better understanding of disease susceptibility and gene sensitivity • Protein replacement therapy • Implementation of preventative measures • More gene therapy applications hgp april 2008

  19. BENEFITS of the HGP • Manipulation of embryo development and aging processes • Microbial genome research for fuel and environmental cleanup • DNA forensics • Protection from biological and chemical warfare • Improved agriculture and livestock • Better understanding of human evolution and migration – DNA mutates at a constant rate • More accurate risk assessment • Bioinformatics – the fastest growing natural science hgp april 2008

  20. … but there is a huge MORAL DILEMMA That which has the potential for good also has the potential for bad. The promise of the Human Genome Project is tempered by the social realities of our modern world. What are some of the moral and ethical issues associated with understanding the Human Genome? Are we as humans prepared to deal with this information? How will you decide your best course of action? hgp april 2008

  21. ETHICAL, LEGAL AND SOCIAL ISSUES (ELSI) Privacy legislation Genetic testing (screening) Patenting - ownership Forensics Behavioral Genetics Genetics in the Courtroom hgp april 2008

  22. OWNERSHIP OF YOUR GENETIC INFORMATION WHO SHOULD HAVE ACCESS TO YOUR GENETIC INFORMATION? Employers, Insurers Schools, Courts Military, Police Adoption agencies WHAT WILL THOSE PEOPLE DO WITH YOUR GENETIC INFORMATION? hgp april 2008

  23. WHO SHOULD OWN AND CONTROL YOUR GENETIC INFORMATION? hgp april 2008

  24. PSYCHOLOGICAL IMPACT AND STIGMATIZATION • Effects on the individual • Effects on society’s perceptions and expectations of the individual hgp april 2008

  25. COMMERCIALIZATION WHO CAN BE ALLOWED TO MAKE MONEY FROM GENES AND DNA SEQUENCES? • The person (or company) who discovered it, or the person whose body it came from? • Should genetic information be the property of humanity? • Is it ethical to charge someone for access to a database of genetic information? hgp april 2008

  26. GENETIC SCREENING • Should testing be done only when there is a family history of genetic disorders? • Should there be screening of whole populations for genetic disorders? • Should testing be done when there is no treatment available? • Who has the right to insist upon genetic testing? hgp april 2008

  27. GENETIC TESTING & REPRODUCTIVE ISSUES • Should genetic screening be undertaken if there are no treatments available for the diseases? • What do you do if genetic testing brings bad news? Who guides you? • Reproductive issues – the use of genetic information in decision-making. hgp april 2008

  28. THIS IS A VERY, VERY COMPLEX ISSUE! WHAT DO YOU THINK? WHERE DO YOU STAND? hgp april 2008